Incidental Mutation 'R7801:Arsb'
List |< first << previous [record 4 of 47] next >> last >|
ID600546
Institutional Source Beutler Lab
Gene Symbol Arsb
Ensembl Gene ENSMUSG00000042082
Gene Namearylsulfatase B
SynonymsAs-1r, As1-s, Ast-1, As-1s, Asr-1, 1110007C02Rik, As1, As1-r, As1-t, As-1, As-1t
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.340) question?
Stock #R7801 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location93771630-93943016 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 93862327 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 381 (I381N)
Ref Sequence ENSEMBL: ENSMUSP00000088964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091403]
Predicted Effect probably damaging
Transcript: ENSMUST00000091403
AA Change: I381N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088964
Gene: ENSMUSG00000042082
AA Change: I381N

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
Pfam:Sulfatase 46 364 1.7e-78 PFAM
Meta Mutation Damage Score 0.9667 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Arylsulfatase B encoded by this gene belongs to the sulfatase family. The arylsulfatase B homodimer hydrolyzes sulfate groups of N-Acetyl-D-galactosamine, chondriotin sulfate, and dermatan sulfate. The protein is targeted to the lysozyme. Mucopolysaccharidosis type VI is an autosomal recessive lysosomal storage disorder resulting from a deficiency of arylsulfatase B. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Dec 2016]
PHENOTYPE: Homozygous mutation of this gene results in development of shortened limbs and snout and a broadened head after 4 weeks of age. Mutant animals have elevated concentrations of glucosaminoglycans in the urine and irregular cartilage structure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A G 1: 89,630,485 Y165C probably damaging Het
Agbl3 A T 6: 34,839,365 T742S probably benign Het
Arhgef10l T C 4: 140,544,267 T651A probably benign Het
Blzf1 A G 1: 164,295,909 V283A probably benign Het
C130060K24Rik T A 6: 65,441,217 V123D probably damaging Het
Cadps C T 14: 12,489,476 probably null Het
Casz1 A T 4: 148,938,249 T591S probably damaging Het
Ccne2 T C 4: 11,194,079 probably null Het
Chst9 T C 18: 15,452,277 T410A probably benign Het
Ciart G A 3: 95,881,344 P61L probably damaging Het
Fam234a T C 17: 26,218,198 D169G probably benign Het
Fat1 C T 8: 45,042,223 P4116L probably damaging Het
Fbxo21 G T 5: 117,986,124 A166S probably damaging Het
Gbf1 A G 19: 46,272,643 I1216V probably benign Het
Gper1 G A 5: 139,426,688 A263T probably benign Het
Hdlbp G T 1: 93,430,307 probably null Het
Ighg3 A T 12: 113,359,816 L280Q Het
Impa1 T C 3: 10,321,667 T171A probably benign Het
Ints7 T A 1: 191,615,747 Y744N possibly damaging Het
Irgc1 G T 7: 24,432,534 A286D probably damaging Het
Kif18a T C 2: 109,287,845 S2P probably damaging Het
Macf1 A T 4: 123,408,271 W813R probably damaging Het
Mapkbp1 T G 2: 120,012,073 H157Q probably damaging Het
Mfsd4b2 T A 10: 39,923,781 M42L probably benign Het
Mon2 A G 10: 123,059,186 probably null Het
Myrfl T A 10: 116,848,335 H161L probably benign Het
Olfr171 T C 16: 19,624,623 H159R probably damaging Het
Olfr832 A C 9: 18,945,259 S204R probably damaging Het
Phlpp2 T G 8: 109,925,842 V606G possibly damaging Het
Psmb5 T C 14: 54,616,755 T89A probably benign Het
Ptpn9 A G 9: 57,061,013 T546A probably benign Het
Rabep2 A G 7: 126,438,412 M146V possibly damaging Het
Rptn G A 3: 93,398,224 E955K possibly damaging Het
Samd3 G T 10: 26,263,872 V301F possibly damaging Het
Sh2b1 C A 7: 126,471,292 C380F probably benign Het
Shank1 A G 7: 44,351,598 M914V unknown Het
Sox2 G A 3: 34,650,642 R76H probably damaging Het
Stat5a T C 11: 100,880,317 F574S probably damaging Het
Tbx5 A G 5: 119,836,999 E29G probably benign Het
Trpm5 A C 7: 143,085,241 D264E probably damaging Het
Zfp442 T C 2: 150,409,719 S88G probably benign Het
Zfp62 T A 11: 49,217,328 F749I possibly damaging Het
Zfp677 T A 17: 21,398,015 S445T probably damaging Het
Zfp979 A C 4: 147,613,978 N91K probably damaging Het
Zfyve9 A G 4: 108,684,995 V209A possibly damaging Het
Zic4 G T 9: 91,384,244 A314S probably benign Het
Other mutations in Arsb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Arsb APN 13 93790100 missense probably benign 0.07
IGL00334:Arsb APN 13 93939279 missense probably benign 0.01
IGL01560:Arsb APN 13 93807598 missense probably benign 0.01
IGL02408:Arsb APN 13 93794162 missense probably benign 0.19
IGL03396:Arsb APN 13 93939317 missense probably benign 0.01
dipper UTSW 13 93790066 missense possibly damaging 0.95
ouzel UTSW 13 93794220 critical splice donor site probably null
rivulet UTSW 13 93862327 missense probably damaging 1.00
R0145:Arsb UTSW 13 93862287 missense possibly damaging 0.60
R0379:Arsb UTSW 13 93940627 missense probably benign 0.20
R0488:Arsb UTSW 13 93940505 missense probably benign
R0560:Arsb UTSW 13 93790198 missense possibly damaging 0.66
R1938:Arsb UTSW 13 93862150 missense probably damaging 1.00
R1968:Arsb UTSW 13 93807559 missense probably benign 0.00
R2209:Arsb UTSW 13 93862101 missense probably benign 0.14
R2224:Arsb UTSW 13 93794171 missense probably damaging 1.00
R2520:Arsb UTSW 13 93940699 nonsense probably null
R4476:Arsb UTSW 13 93807595 missense probably damaging 1.00
R4910:Arsb UTSW 13 93771977 missense probably benign
R5153:Arsb UTSW 13 93940598 missense probably benign 0.20
R5185:Arsb UTSW 13 93794159 missense probably damaging 1.00
R5272:Arsb UTSW 13 93794162 missense possibly damaging 0.86
R5475:Arsb UTSW 13 93862265 missense probably benign 0.00
R5580:Arsb UTSW 13 93807545 missense probably damaging 1.00
R6371:Arsb UTSW 13 93790066 missense possibly damaging 0.95
R6668:Arsb UTSW 13 93794220 critical splice donor site probably null
R7084:Arsb UTSW 13 93940616 missense probably benign 0.00
R7735:Arsb UTSW 13 93771983 missense probably benign 0.00
R7859:Arsb UTSW 13 93862107 missense probably benign 0.03
X0010:Arsb UTSW 13 93794202 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTAGGTCTGGAGGCAACAACTG -3'
(R):5'- ATGGTGACTCTCATGCTCAGG -3'

Sequencing Primer
(F):5'- AACTGGCCACTCCGAGGAAG -3'
(R):5'- ACTCTCATGCTCAGGGGTGAC -3'
Posted On2019-11-26