Incidental Mutation 'R7801:Cadps'
ID600547
Institutional Source Beutler Lab
Gene Symbol Cadps
Ensembl Gene ENSMUSG00000054423
Gene NameCa2+-dependent secretion activator
SynonymsCAPS1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7801 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location12372563-12823079 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 12489476 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000064706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067491] [ENSMUST00000067491] [ENSMUST00000112657] [ENSMUST00000112657] [ENSMUST00000112658] [ENSMUST00000112658] [ENSMUST00000177814] [ENSMUST00000177814] [ENSMUST00000224882]
Predicted Effect probably null
Transcript: ENSMUST00000067491
SMART Domains Protein: ENSMUSP00000064706
Gene: ENSMUSG00000054423

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 41 75 N/A INTRINSIC
coiled coil region 93 121 N/A INTRINSIC
C2 397 492 1.08e-2 SMART
PH 520 624 1.78e-10 SMART
low complexity region 772 783 N/A INTRINSIC
DUF1041 833 948 6.21e-54 SMART
low complexity region 1022 1045 N/A INTRINSIC
low complexity region 1354 1361 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000067491
SMART Domains Protein: ENSMUSP00000064706
Gene: ENSMUSG00000054423

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 41 75 N/A INTRINSIC
coiled coil region 93 121 N/A INTRINSIC
C2 397 492 1.08e-2 SMART
PH 520 624 1.78e-10 SMART
low complexity region 772 783 N/A INTRINSIC
DUF1041 833 948 6.21e-54 SMART
low complexity region 1022 1045 N/A INTRINSIC
low complexity region 1354 1361 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112657
SMART Domains Protein: ENSMUSP00000108276
Gene: ENSMUSG00000054423

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 41 75 N/A INTRINSIC
coiled coil region 93 121 N/A INTRINSIC
C2 397 492 1.08e-2 SMART
PH 520 624 1.78e-10 SMART
low complexity region 775 786 N/A INTRINSIC
DUF1041 836 941 3.88e-55 SMART
low complexity region 1015 1038 N/A INTRINSIC
low complexity region 1347 1354 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112657
SMART Domains Protein: ENSMUSP00000108276
Gene: ENSMUSG00000054423

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 41 75 N/A INTRINSIC
coiled coil region 93 121 N/A INTRINSIC
C2 397 492 1.08e-2 SMART
PH 520 624 1.78e-10 SMART
low complexity region 775 786 N/A INTRINSIC
DUF1041 836 941 3.88e-55 SMART
low complexity region 1015 1038 N/A INTRINSIC
low complexity region 1347 1354 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112658
SMART Domains Protein: ENSMUSP00000108277
Gene: ENSMUSG00000054423

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 41 75 N/A INTRINSIC
coiled coil region 93 121 N/A INTRINSIC
C2 397 492 1.08e-2 SMART
PH 520 624 1.78e-10 SMART
low complexity region 776 787 N/A INTRINSIC
DUF1041 837 942 3.88e-55 SMART
low complexity region 1016 1039 N/A INTRINSIC
low complexity region 1348 1355 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112658
SMART Domains Protein: ENSMUSP00000108277
Gene: ENSMUSG00000054423

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 41 75 N/A INTRINSIC
coiled coil region 93 121 N/A INTRINSIC
C2 397 492 1.08e-2 SMART
PH 520 624 1.78e-10 SMART
low complexity region 776 787 N/A INTRINSIC
DUF1041 837 942 3.88e-55 SMART
low complexity region 1016 1039 N/A INTRINSIC
low complexity region 1348 1355 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000177814
SMART Domains Protein: ENSMUSP00000136076
Gene: ENSMUSG00000054423

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 41 75 N/A INTRINSIC
coiled coil region 93 121 N/A INTRINSIC
C2 397 492 1.08e-2 SMART
PH 520 624 1.78e-10 SMART
low complexity region 777 788 N/A INTRINSIC
DUF1041 838 943 2.75e-55 SMART
low complexity region 1017 1040 N/A INTRINSIC
low complexity region 1349 1356 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000177814
SMART Domains Protein: ENSMUSP00000136076
Gene: ENSMUSG00000054423

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 41 75 N/A INTRINSIC
coiled coil region 93 121 N/A INTRINSIC
C2 397 492 1.08e-2 SMART
PH 520 624 1.78e-10 SMART
low complexity region 777 788 N/A INTRINSIC
DUF1041 838 943 2.75e-55 SMART
low complexity region 1017 1040 N/A INTRINSIC
low complexity region 1349 1356 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224581
Predicted Effect probably benign
Transcript: ENSMUST00000224882
Meta Mutation Damage Score 0.9488 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a novel neural/endocrine-specific cytosolic and peripheral membrane protein required for the Ca2+-regulated exocytosis of secretory vesicles. The protein acts at a stage in exocytosis that follows ATP-dependent priming, which involves the essential synthesis of phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2). Alternative splicing has been observed at this locus and three variants, encoding distinct isoforms, are described. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygous null mice display neonatal lethality, respiratory failure and abnormal adrenal gland physiology. Adult heterozygous null mice display abnormal adrenal gland physiology that is different from that seen in homozygous neonates. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A G 1: 89,630,485 Y165C probably damaging Het
Agbl3 A T 6: 34,839,365 T742S probably benign Het
Arhgef10l T C 4: 140,544,267 T651A probably benign Het
Arsb T A 13: 93,862,327 I381N probably damaging Het
Blzf1 A G 1: 164,295,909 V283A probably benign Het
C130060K24Rik T A 6: 65,441,217 V123D probably damaging Het
Casz1 A T 4: 148,938,249 T591S probably damaging Het
Ccne2 T C 4: 11,194,079 probably null Het
Chst9 T C 18: 15,452,277 T410A probably benign Het
Ciart G A 3: 95,881,344 P61L probably damaging Het
Fam234a T C 17: 26,218,198 D169G probably benign Het
Fat1 C T 8: 45,042,223 P4116L probably damaging Het
Fbxo21 G T 5: 117,986,124 A166S probably damaging Het
Gbf1 A G 19: 46,272,643 I1216V probably benign Het
Gper1 G A 5: 139,426,688 A263T probably benign Het
Hdlbp G T 1: 93,430,307 probably null Het
Ighg3 A T 12: 113,359,816 L280Q Het
Impa1 T C 3: 10,321,667 T171A probably benign Het
Ints7 T A 1: 191,615,747 Y744N possibly damaging Het
Irgc1 G T 7: 24,432,534 A286D probably damaging Het
Kif18a T C 2: 109,287,845 S2P probably damaging Het
Macf1 A T 4: 123,408,271 W813R probably damaging Het
Mapkbp1 T G 2: 120,012,073 H157Q probably damaging Het
Mfsd4b2 T A 10: 39,923,781 M42L probably benign Het
Mon2 A G 10: 123,059,186 probably null Het
Myrfl T A 10: 116,848,335 H161L probably benign Het
Olfr171 T C 16: 19,624,623 H159R probably damaging Het
Olfr832 A C 9: 18,945,259 S204R probably damaging Het
Phlpp2 T G 8: 109,925,842 V606G possibly damaging Het
Psmb5 T C 14: 54,616,755 T89A probably benign Het
Ptpn9 A G 9: 57,061,013 T546A probably benign Het
Rabep2 A G 7: 126,438,412 M146V possibly damaging Het
Rptn G A 3: 93,398,224 E955K possibly damaging Het
Samd3 G T 10: 26,263,872 V301F possibly damaging Het
Sh2b1 C A 7: 126,471,292 C380F probably benign Het
Shank1 A G 7: 44,351,598 M914V unknown Het
Sox2 G A 3: 34,650,642 R76H probably damaging Het
Stat5a T C 11: 100,880,317 F574S probably damaging Het
Tbx5 A G 5: 119,836,999 E29G probably benign Het
Trpm5 A C 7: 143,085,241 D264E probably damaging Het
Zfp442 T C 2: 150,409,719 S88G probably benign Het
Zfp62 T A 11: 49,217,328 F749I possibly damaging Het
Zfp677 T A 17: 21,398,015 S445T probably damaging Het
Zfp979 A C 4: 147,613,978 N91K probably damaging Het
Zfyve9 A G 4: 108,684,995 V209A possibly damaging Het
Zic4 G T 9: 91,384,244 A314S probably benign Het
Other mutations in Cadps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Cadps APN 14 12491795 missense probably damaging 1.00
IGL00990:Cadps APN 14 12715374 missense possibly damaging 0.56
IGL01071:Cadps APN 14 12509091 splice site probably null
IGL01339:Cadps APN 14 12486543 missense possibly damaging 0.58
IGL01518:Cadps APN 14 12522352 missense probably damaging 1.00
IGL01560:Cadps APN 14 12491792 missense probably damaging 1.00
IGL01598:Cadps APN 14 12522202 critical splice donor site probably null
IGL01603:Cadps APN 14 12454154 splice site probably benign
IGL01836:Cadps APN 14 12522311 missense probably damaging 1.00
IGL01839:Cadps APN 14 12467184 splice site probably benign
IGL01932:Cadps APN 14 12373609 utr 3 prime probably benign
IGL02172:Cadps APN 14 12705681 missense probably damaging 1.00
IGL02175:Cadps APN 14 12467092 missense probably damaging 0.96
IGL02212:Cadps APN 14 12522345 missense possibly damaging 0.94
IGL02351:Cadps APN 14 12597380 missense probably damaging 0.99
IGL02358:Cadps APN 14 12597380 missense probably damaging 0.99
IGL02499:Cadps APN 14 12822725 nonsense probably null
IGL02505:Cadps APN 14 12449759 missense probably damaging 1.00
IGL02591:Cadps APN 14 12473465 missense probably damaging 1.00
IGL02592:Cadps APN 14 12473465 missense probably damaging 1.00
IGL02671:Cadps APN 14 12491824 missense probably damaging 1.00
IGL02956:Cadps APN 14 12418047 splice site probably benign
IGL03029:Cadps APN 14 12376675 missense probably damaging 1.00
IGL03216:Cadps APN 14 12439944 missense probably damaging 1.00
IGL03282:Cadps APN 14 12465856 splice site probably benign
turbo UTSW 14 12491800 missense probably damaging 1.00
R0241:Cadps UTSW 14 12376675 missense probably damaging 1.00
R0241:Cadps UTSW 14 12376675 missense probably damaging 1.00
R0420:Cadps UTSW 14 12491800 missense probably damaging 1.00
R1180:Cadps UTSW 14 12457836 splice site probably benign
R1398:Cadps UTSW 14 12449822 missense probably damaging 1.00
R1678:Cadps UTSW 14 12517802 critical splice donor site probably null
R1792:Cadps UTSW 14 12449802 missense possibly damaging 0.93
R1863:Cadps UTSW 14 12449802 missense possibly damaging 0.93
R1863:Cadps UTSW 14 12505796 missense probably benign 0.09
R1918:Cadps UTSW 14 12546372 missense probably damaging 0.99
R1920:Cadps UTSW 14 12465859 missense possibly damaging 0.64
R1921:Cadps UTSW 14 12465859 missense possibly damaging 0.64
R1922:Cadps UTSW 14 12465859 missense possibly damaging 0.64
R1925:Cadps UTSW 14 12705726 missense probably damaging 1.00
R1966:Cadps UTSW 14 12822450 nonsense probably null
R2013:Cadps UTSW 14 12522337 missense probably damaging 1.00
R2228:Cadps UTSW 14 12465935 missense probably benign 0.05
R2331:Cadps UTSW 14 12603692 missense probably damaging 1.00
R3436:Cadps UTSW 14 12616158 splice site probably null
R3853:Cadps UTSW 14 12509090 splice site probably benign
R3893:Cadps UTSW 14 12488883 utr 3 prime probably benign
R3916:Cadps UTSW 14 12457702 missense probably benign 0.00
R3917:Cadps UTSW 14 12457702 missense probably benign 0.00
R3953:Cadps UTSW 14 12505937 missense probably damaging 1.00
R3966:Cadps UTSW 14 12522161 splice site probably null
R4024:Cadps UTSW 14 12705539 missense probably damaging 1.00
R4079:Cadps UTSW 14 12457702 missense probably benign 0.00
R4230:Cadps UTSW 14 12488987 missense probably damaging 0.98
R4333:Cadps UTSW 14 12467031 missense probably damaging 1.00
R4410:Cadps UTSW 14 12822323 missense probably damaging 0.98
R4586:Cadps UTSW 14 12505808 missense probably damaging 1.00
R4685:Cadps UTSW 14 12467139 missense possibly damaging 0.77
R4698:Cadps UTSW 14 12705654 missense possibly damaging 0.90
R4855:Cadps UTSW 14 12822449 missense unknown
R4898:Cadps UTSW 14 12411588 missense possibly damaging 0.86
R4908:Cadps UTSW 14 12536386 missense probably damaging 1.00
R5208:Cadps UTSW 14 12457711 missense possibly damaging 0.68
R5297:Cadps UTSW 14 12822345 missense probably damaging 1.00
R5328:Cadps UTSW 14 12457790 missense probably benign 0.31
R5408:Cadps UTSW 14 12705759 missense possibly damaging 0.87
R5529:Cadps UTSW 14 12454285 missense probably damaging 1.00
R5567:Cadps UTSW 14 12473497 missense possibly damaging 0.49
R5570:Cadps UTSW 14 12473497 missense possibly damaging 0.49
R5727:Cadps UTSW 14 12486525 nonsense probably null
R5812:Cadps UTSW 14 12376685 missense probably benign
R6361:Cadps UTSW 14 12491778 nonsense probably null
R6767:Cadps UTSW 14 12550888 missense probably damaging 1.00
R6805:Cadps UTSW 14 12467103 missense probably damaging 0.99
R6861:Cadps UTSW 14 12522401 nonsense probably null
R6883:Cadps UTSW 14 12465883 missense probably damaging 0.96
R6887:Cadps UTSW 14 12505811 missense probably damaging 1.00
R6997:Cadps UTSW 14 12505793 missense possibly damaging 0.88
R7102:Cadps UTSW 14 12603738 missense probably damaging 1.00
R7120:Cadps UTSW 14 12439919 missense probably damaging 0.98
R7143:Cadps UTSW 14 12491838 missense probably benign 0.02
R7290:Cadps UTSW 14 12616099 missense probably damaging 1.00
R7614:Cadps UTSW 14 12454260 missense probably damaging 1.00
R7674:Cadps UTSW 14 12411581 missense probably damaging 0.99
R7715:Cadps UTSW 14 12457762 missense probably benign 0.01
R7814:Cadps UTSW 14 12376706 missense probably damaging 0.99
R7915:Cadps UTSW 14 12705544 missense possibly damaging 0.84
R8087:Cadps UTSW 14 12536380 missense probably damaging 1.00
R8109:Cadps UTSW 14 12488975 missense probably benign 0.00
X0018:Cadps UTSW 14 12373690 missense probably damaging 1.00
X0028:Cadps UTSW 14 12467118 missense possibly damaging 0.93
Z1088:Cadps UTSW 14 12467113 missense probably damaging 0.96
Z1177:Cadps UTSW 14 12465880 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCGGTGACAAAGCTTGTG -3'
(R):5'- AAAGCATTTTCCATTCCTCGG -3'

Sequencing Primer
(F):5'- CAAAGCTTGTGCAGGCATC -3'
(R):5'- CCATTCCTCGGTATAAGTTGCTATAG -3'
Posted On2019-11-26