Incidental Mutation 'R7801:Psmb5'
List |< first << previous [record 31 of 47] next >> last >|
ID600548
Institutional Source Beutler Lab
Gene Symbol Psmb5
Ensembl Gene ENSMUSG00000022193
Gene Nameproteasome (prosome, macropain) subunit, beta type 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R7801 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location54614119-54618022 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54616755 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 89 (T89A)
Ref Sequence ENSEMBL: ENSMUSP00000022803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022803] [ENSMUST00000227257] [ENSMUST00000228446]
PDB Structure
Mouse constitutive 20S proteasome in complex with PR-957 [X-RAY DIFFRACTION]
Mouse constitutive 20S proteasome [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000022803
AA Change: T89A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000022803
Gene: ENSMUSG00000022193
AA Change: T89A

DomainStartEndE-ValueType
low complexity region 17 42 N/A INTRINSIC
Pfam:Proteasome 56 238 8.3e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102174
Predicted Effect probably benign
Transcript: ENSMUST00000227257
Predicted Effect probably benign
Transcript: ENSMUST00000228446
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit in the proteasome. This catalytic subunit is not present in the immunoproteasome and is replaced by catalytic subunit 3i (proteasome beta 8 subunit). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A G 1: 89,630,485 Y165C probably damaging Het
Agbl3 A T 6: 34,839,365 T742S probably benign Het
Arhgef10l T C 4: 140,544,267 T651A probably benign Het
Arsb T A 13: 93,862,327 I381N probably damaging Het
Blzf1 A G 1: 164,295,909 V283A probably benign Het
C130060K24Rik T A 6: 65,441,217 V123D probably damaging Het
Cadps C T 14: 12,489,476 probably null Het
Casz1 A T 4: 148,938,249 T591S probably damaging Het
Ccne2 T C 4: 11,194,079 probably null Het
Chst9 T C 18: 15,452,277 T410A probably benign Het
Ciart G A 3: 95,881,344 P61L probably damaging Het
Fam234a T C 17: 26,218,198 D169G probably benign Het
Fat1 C T 8: 45,042,223 P4116L probably damaging Het
Fbxo21 G T 5: 117,986,124 A166S probably damaging Het
Gbf1 A G 19: 46,272,643 I1216V probably benign Het
Gper1 G A 5: 139,426,688 A263T probably benign Het
Hdlbp G T 1: 93,430,307 probably null Het
Ighg3 A T 12: 113,359,816 L280Q Het
Impa1 T C 3: 10,321,667 T171A probably benign Het
Ints7 T A 1: 191,615,747 Y744N possibly damaging Het
Irgc1 G T 7: 24,432,534 A286D probably damaging Het
Kif18a T C 2: 109,287,845 S2P probably damaging Het
Macf1 A T 4: 123,408,271 W813R probably damaging Het
Mapkbp1 T G 2: 120,012,073 H157Q probably damaging Het
Mfsd4b2 T A 10: 39,923,781 M42L probably benign Het
Mon2 A G 10: 123,059,186 probably null Het
Myrfl T A 10: 116,848,335 H161L probably benign Het
Olfr171 T C 16: 19,624,623 H159R probably damaging Het
Olfr832 A C 9: 18,945,259 S204R probably damaging Het
Phlpp2 T G 8: 109,925,842 V606G possibly damaging Het
Ptpn9 A G 9: 57,061,013 T546A probably benign Het
Rabep2 A G 7: 126,438,412 M146V possibly damaging Het
Rptn G A 3: 93,398,224 E955K possibly damaging Het
Samd3 G T 10: 26,263,872 V301F possibly damaging Het
Sh2b1 C A 7: 126,471,292 C380F probably benign Het
Shank1 A G 7: 44,351,598 M914V unknown Het
Sox2 G A 3: 34,650,642 R76H probably damaging Het
Stat5a T C 11: 100,880,317 F574S probably damaging Het
Tbx5 A G 5: 119,836,999 E29G probably benign Het
Trpm5 A C 7: 143,085,241 D264E probably damaging Het
Zfp442 T C 2: 150,409,719 S88G probably benign Het
Zfp62 T A 11: 49,217,328 F749I possibly damaging Het
Zfp677 T A 17: 21,398,015 S445T probably damaging Het
Zfp979 A C 4: 147,613,978 N91K probably damaging Het
Zfyve9 A G 4: 108,684,995 V209A possibly damaging Het
Zic4 G T 9: 91,384,244 A314S probably benign Het
Other mutations in Psmb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Psmb5 APN 14 54617807 missense possibly damaging 0.85
IGL02967:Psmb5 APN 14 54616626 missense probably benign 0.11
IGL03095:Psmb5 APN 14 54616557 missense probably damaging 1.00
R2447:Psmb5 UTSW 14 54614470 missense probably damaging 0.97
R5651:Psmb5 UTSW 14 54616764 missense possibly damaging 0.64
R6346:Psmb5 UTSW 14 54616673 missense probably damaging 0.98
R6372:Psmb5 UTSW 14 54616673 missense probably damaging 0.98
R6657:Psmb5 UTSW 14 54614383 missense possibly damaging 0.61
R6687:Psmb5 UTSW 14 54616673 missense probably damaging 0.98
R6688:Psmb5 UTSW 14 54616673 missense probably damaging 0.98
R6752:Psmb5 UTSW 14 54616755 missense probably benign 0.00
R7007:Psmb5 UTSW 14 54616709 missense probably damaging 0.99
R8066:Psmb5 UTSW 14 54614241 missense probably benign 0.00
R8278:Psmb5 UTSW 14 54617885 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TCTTATCCCAGCCACAGATCATG -3'
(R):5'- GATGCAAAGCCAGGTTATCTTTC -3'

Sequencing Primer
(F):5'- GTACTGATACACCATGTTAGCGAGC -3'
(R):5'- GTTTCTCCATGGAGTCATT -3'
Posted On2019-11-26