Incidental Mutation 'R7801:Zfp677'
ID 600550
Institutional Source Beutler Lab
Gene Symbol Zfp677
Ensembl Gene ENSMUSG00000062743
Gene Name zinc finger protein 677
Synonyms A830058L05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock # R7801 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 21383748-21399265 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 21398015 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 445 (S445T)
Ref Sequence ENSEMBL: ENSMUSP00000052667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056107] [ENSMUST00000162659]
AlphaFold Q6PEP4
Predicted Effect probably damaging
Transcript: ENSMUST00000056107
AA Change: S445T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052667
Gene: ENSMUSG00000062743
AA Change: S445T

DomainStartEndE-ValueType
KRAB 13 75 1.11e-21 SMART
ZnF_C2H2 185 207 2.95e-3 SMART
ZnF_C2H2 213 235 3.95e-4 SMART
ZnF_C2H2 241 263 2.09e-3 SMART
ZnF_C2H2 269 291 6.42e-4 SMART
ZnF_C2H2 297 319 5.5e-3 SMART
ZnF_C2H2 325 347 1.98e-4 SMART
ZnF_C2H2 353 375 1.98e-4 SMART
ZnF_C2H2 381 403 1.47e-3 SMART
ZnF_C2H2 409 431 1.28e-3 SMART
ZnF_C2H2 437 459 3.95e-4 SMART
ZnF_C2H2 465 487 1.04e-3 SMART
ZnF_C2H2 493 515 8.47e-4 SMART
ZnF_C2H2 521 543 7.49e-5 SMART
ZnF_C2H2 549 571 1.18e-2 SMART
ZnF_C2H2 577 599 6.08e-5 SMART
ZnF_C2H2 610 632 4.17e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162659
AA Change: S445T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125295
Gene: ENSMUSG00000062743
AA Change: S445T

DomainStartEndE-ValueType
KRAB 13 75 1.11e-21 SMART
Pfam:zf-H2C2_2 118 140 2.9e-5 PFAM
ZnF_C2H2 185 207 2.95e-3 SMART
ZnF_C2H2 213 235 3.95e-4 SMART
ZnF_C2H2 241 263 2.09e-3 SMART
ZnF_C2H2 269 291 6.42e-4 SMART
ZnF_C2H2 297 319 5.5e-3 SMART
ZnF_C2H2 325 347 1.98e-4 SMART
ZnF_C2H2 353 375 1.98e-4 SMART
ZnF_C2H2 381 403 1.47e-3 SMART
ZnF_C2H2 409 431 1.28e-3 SMART
ZnF_C2H2 437 459 3.95e-4 SMART
ZnF_C2H2 465 487 1.04e-3 SMART
ZnF_C2H2 493 515 8.47e-4 SMART
ZnF_C2H2 521 543 7.49e-5 SMART
ZnF_C2H2 549 571 1.18e-2 SMART
ZnF_C2H2 577 599 6.08e-5 SMART
ZnF_C2H2 610 632 4.17e-3 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A G 1: 89,630,485 Y165C probably damaging Het
Agbl3 A T 6: 34,839,365 T742S probably benign Het
Arhgef10l T C 4: 140,544,267 T651A probably benign Het
Arsb T A 13: 93,862,327 I381N probably damaging Het
Blzf1 A G 1: 164,295,909 V283A probably benign Het
C130060K24Rik T A 6: 65,441,217 V123D probably damaging Het
Cadps C T 14: 12,489,476 probably null Het
Casz1 A T 4: 148,938,249 T591S probably damaging Het
Ccne2 T C 4: 11,194,079 probably null Het
Chst9 T C 18: 15,452,277 T410A probably benign Het
Ciart G A 3: 95,881,344 P61L probably damaging Het
Fam234a T C 17: 26,218,198 D169G probably benign Het
Fat1 C T 8: 45,042,223 P4116L probably damaging Het
Fbxo21 G T 5: 117,986,124 A166S probably damaging Het
Gbf1 A G 19: 46,272,643 I1216V probably benign Het
Gper1 G A 5: 139,426,688 A263T probably benign Het
Hdlbp G T 1: 93,430,307 probably null Het
Ighg3 A T 12: 113,359,816 L280Q Het
Impa1 T C 3: 10,321,667 T171A probably benign Het
Ints7 T A 1: 191,615,747 Y744N possibly damaging Het
Irgc1 G T 7: 24,432,534 A286D probably damaging Het
Kif18a T C 2: 109,287,845 S2P probably damaging Het
Macf1 A T 4: 123,408,271 W813R probably damaging Het
Mapkbp1 T G 2: 120,012,073 H157Q probably damaging Het
Mfsd4b2 T A 10: 39,923,781 M42L probably benign Het
Mon2 A G 10: 123,059,186 probably null Het
Myrfl T A 10: 116,848,335 H161L probably benign Het
Olfr171 T C 16: 19,624,623 H159R probably damaging Het
Olfr832 A C 9: 18,945,259 S204R probably damaging Het
Phlpp2 T G 8: 109,925,842 V606G possibly damaging Het
Psmb5 T C 14: 54,616,755 T89A probably benign Het
Ptpn9 A G 9: 57,061,013 T546A probably benign Het
Rabep2 A G 7: 126,438,412 M146V possibly damaging Het
Rptn G A 3: 93,398,224 E955K possibly damaging Het
Samd3 G T 10: 26,263,872 V301F possibly damaging Het
Sh2b1 C A 7: 126,471,292 C380F probably benign Het
Shank1 A G 7: 44,351,598 M914V unknown Het
Sox2 G A 3: 34,650,642 R76H probably damaging Het
Stat5a T C 11: 100,880,317 F574S probably damaging Het
Tbx5 A G 5: 119,836,999 E29G probably benign Het
Trpm5 A C 7: 143,085,241 D264E probably damaging Het
Zfp442 T C 2: 150,409,719 S88G probably benign Het
Zfp62 T A 11: 49,217,328 F749I possibly damaging Het
Zfp979 A C 4: 147,613,978 N91K probably damaging Het
Zfyve9 A G 4: 108,684,995 V209A possibly damaging Het
Zic4 G T 9: 91,384,244 A314S probably benign Het
Other mutations in Zfp677
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Zfp677 APN 17 21397668 missense probably benign 0.33
IGL01973:Zfp677 APN 17 21396907 missense probably damaging 1.00
IGL02206:Zfp677 APN 17 21393237 missense probably damaging 1.00
IGL03240:Zfp677 APN 17 21396873 missense probably damaging 0.99
IGL03409:Zfp677 APN 17 21396845 missense probably damaging 1.00
R0622:Zfp677 UTSW 17 21397700 missense probably benign 0.04
R0972:Zfp677 UTSW 17 21398310 missense probably damaging 1.00
R1519:Zfp677 UTSW 17 21397237 missense possibly damaging 0.91
R2155:Zfp677 UTSW 17 21397708 missense probably benign 0.01
R2316:Zfp677 UTSW 17 21397320 missense probably benign 0.38
R2866:Zfp677 UTSW 17 21397256 nonsense probably null
R2989:Zfp677 UTSW 17 21396852 missense probably benign 0.11
R3955:Zfp677 UTSW 17 21397817 missense possibly damaging 0.95
R4075:Zfp677 UTSW 17 21398159 missense probably damaging 1.00
R4134:Zfp677 UTSW 17 21397781 missense probably benign 0.01
R4229:Zfp677 UTSW 17 21398282 missense probably damaging 1.00
R4729:Zfp677 UTSW 17 21397418 missense possibly damaging 0.51
R4843:Zfp677 UTSW 17 21392526 missense probably benign 0.23
R5023:Zfp677 UTSW 17 21397794 missense probably damaging 1.00
R5316:Zfp677 UTSW 17 21397148 missense probably damaging 0.99
R5420:Zfp677 UTSW 17 21397913 missense probably damaging 1.00
R5694:Zfp677 UTSW 17 21397759 missense probably damaging 0.99
R5837:Zfp677 UTSW 17 21397386 missense probably damaging 1.00
R5888:Zfp677 UTSW 17 21398258 missense probably damaging 1.00
R6007:Zfp677 UTSW 17 21397656 missense probably damaging 1.00
R6119:Zfp677 UTSW 17 21397808 missense possibly damaging 0.55
R6190:Zfp677 UTSW 17 21397268 missense possibly damaging 0.91
R6518:Zfp677 UTSW 17 21398130 missense probably damaging 1.00
R7198:Zfp677 UTSW 17 21398417 missense probably damaging 1.00
R7391:Zfp677 UTSW 17 21398391 missense possibly damaging 0.56
R7808:Zfp677 UTSW 17 21397385 missense probably damaging 1.00
R8202:Zfp677 UTSW 17 21393273 missense probably damaging 1.00
R8206:Zfp677 UTSW 17 21392455 splice site probably null
R8885:Zfp677 UTSW 17 21398088 missense probably benign
R8965:Zfp677 UTSW 17 21396893 missense probably damaging 1.00
R9062:Zfp677 UTSW 17 21392553 critical splice donor site probably null
R9167:Zfp677 UTSW 17 21393198 missense probably damaging 1.00
R9371:Zfp677 UTSW 17 21397791 missense probably damaging 1.00
R9638:Zfp677 UTSW 17 21397794 missense probably damaging 1.00
RF003:Zfp677 UTSW 17 21397442 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCATTTACTCAGTCCTCATCCC -3'
(R):5'- TCAGTAAAGGATTTGTCACATTCC -3'

Sequencing Primer
(F):5'- CCCTATAAGTGCAACATTTGTGG -3'
(R):5'- CCACTATGCAAATTCTGATGGC -3'
Posted On 2019-11-26