Incidental Mutation 'R7801:Fam234a'
ID600551
Institutional Source Beutler Lab
Gene Symbol Fam234a
Ensembl Gene ENSMUSG00000024187
Gene Namefamily with sequence similarity 234, member A
SynonymsItfg3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R7801 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location26211822-26244223 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26218198 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 169 (D169G)
Ref Sequence ENSEMBL: ENSMUSP00000110639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114988] [ENSMUST00000118487] [ENSMUST00000151293]
Predicted Effect probably benign
Transcript: ENSMUST00000114988
AA Change: D169G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000110639
Gene: ENSMUSG00000024187
AA Change: D169G

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
low complexity region 218 233 N/A INTRINSIC
low complexity region 415 425 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118487
AA Change: D169G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000113418
Gene: ENSMUSG00000024187
AA Change: D169G

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
low complexity region 218 233 N/A INTRINSIC
low complexity region 415 425 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141240
Predicted Effect probably benign
Transcript: ENSMUST00000151293
SMART Domains Protein: ENSMUSP00000117020
Gene: ENSMUSG00000024187

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A G 1: 89,630,485 Y165C probably damaging Het
Agbl3 A T 6: 34,839,365 T742S probably benign Het
Arhgef10l T C 4: 140,544,267 T651A probably benign Het
Arsb T A 13: 93,862,327 I381N probably damaging Het
Blzf1 A G 1: 164,295,909 V283A probably benign Het
C130060K24Rik T A 6: 65,441,217 V123D probably damaging Het
Cadps C T 14: 12,489,476 probably null Het
Casz1 A T 4: 148,938,249 T591S probably damaging Het
Ccne2 T C 4: 11,194,079 probably null Het
Chst9 T C 18: 15,452,277 T410A probably benign Het
Ciart G A 3: 95,881,344 P61L probably damaging Het
Fat1 C T 8: 45,042,223 P4116L probably damaging Het
Fbxo21 G T 5: 117,986,124 A166S probably damaging Het
Gbf1 A G 19: 46,272,643 I1216V probably benign Het
Gper1 G A 5: 139,426,688 A263T probably benign Het
Hdlbp G T 1: 93,430,307 probably null Het
Ighg3 A T 12: 113,359,816 L280Q Het
Impa1 T C 3: 10,321,667 T171A probably benign Het
Ints7 T A 1: 191,615,747 Y744N possibly damaging Het
Irgc1 G T 7: 24,432,534 A286D probably damaging Het
Kif18a T C 2: 109,287,845 S2P probably damaging Het
Macf1 A T 4: 123,408,271 W813R probably damaging Het
Mapkbp1 T G 2: 120,012,073 H157Q probably damaging Het
Mfsd4b2 T A 10: 39,923,781 M42L probably benign Het
Mon2 A G 10: 123,059,186 probably null Het
Myrfl T A 10: 116,848,335 H161L probably benign Het
Olfr171 T C 16: 19,624,623 H159R probably damaging Het
Olfr832 A C 9: 18,945,259 S204R probably damaging Het
Phlpp2 T G 8: 109,925,842 V606G possibly damaging Het
Psmb5 T C 14: 54,616,755 T89A probably benign Het
Ptpn9 A G 9: 57,061,013 T546A probably benign Het
Rabep2 A G 7: 126,438,412 M146V possibly damaging Het
Rptn G A 3: 93,398,224 E955K possibly damaging Het
Samd3 G T 10: 26,263,872 V301F possibly damaging Het
Sh2b1 C A 7: 126,471,292 C380F probably benign Het
Shank1 A G 7: 44,351,598 M914V unknown Het
Sox2 G A 3: 34,650,642 R76H probably damaging Het
Stat5a T C 11: 100,880,317 F574S probably damaging Het
Tbx5 A G 5: 119,836,999 E29G probably benign Het
Trpm5 A C 7: 143,085,241 D264E probably damaging Het
Zfp442 T C 2: 150,409,719 S88G probably benign Het
Zfp62 T A 11: 49,217,328 F749I possibly damaging Het
Zfp677 T A 17: 21,398,015 S445T probably damaging Het
Zfp979 A C 4: 147,613,978 N91K probably damaging Het
Zfyve9 A G 4: 108,684,995 V209A possibly damaging Het
Zic4 G T 9: 91,384,244 A314S probably benign Het
Other mutations in Fam234a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00907:Fam234a APN 17 26213526 missense probably damaging 1.00
IGL02635:Fam234a APN 17 26214453 missense possibly damaging 0.63
R0269:Fam234a UTSW 17 26216617 missense probably benign
R0617:Fam234a UTSW 17 26216617 missense probably benign
R1687:Fam234a UTSW 17 26215308 missense probably damaging 1.00
R1971:Fam234a UTSW 17 26216655 splice site probably null
R2016:Fam234a UTSW 17 26218316 missense probably benign 0.07
R3826:Fam234a UTSW 17 26218189 missense probably benign
R3827:Fam234a UTSW 17 26218189 missense probably benign
R3829:Fam234a UTSW 17 26218189 missense probably benign
R4133:Fam234a UTSW 17 26213558 missense probably damaging 0.99
R4190:Fam234a UTSW 17 26213860 missense probably damaging 0.98
R4193:Fam234a UTSW 17 26213860 missense probably damaging 0.98
R4858:Fam234a UTSW 17 26216617 missense probably benign
R4885:Fam234a UTSW 17 26213585 missense probably benign 0.00
R5117:Fam234a UTSW 17 26213538 missense probably benign 0.18
R5719:Fam234a UTSW 17 26214653 missense possibly damaging 0.52
R5735:Fam234a UTSW 17 26213705 missense probably damaging 1.00
R6271:Fam234a UTSW 17 26218237 missense probably benign 0.19
R6341:Fam234a UTSW 17 26213693 missense probably damaging 1.00
R6365:Fam234a UTSW 17 26220455 nonsense probably null
R6621:Fam234a UTSW 17 26213881 missense probably damaging 1.00
R7393:Fam234a UTSW 17 26216624 missense probably benign 0.01
R7956:Fam234a UTSW 17 26216577 missense probably damaging 1.00
R8324:Fam234a UTSW 17 26218698 missense probably benign 0.11
R8393:Fam234a UTSW 17 26218175 missense probably damaging 1.00
RF020:Fam234a UTSW 17 26218751 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- TGACTTCCAAATGGTCACACC -3'
(R):5'- TGTCATGTGCCTGAGACACAG -3'

Sequencing Primer
(F):5'- ATGGTCACACCCTCACTTGGAG -3'
(R):5'- GACAGGAGGTGGCATGC -3'
Posted On2019-11-26