Incidental Mutation 'R7801:Chst9'
ID600552
Institutional Source Beutler Lab
Gene Symbol Chst9
Ensembl Gene ENSMUSG00000047161
Gene Namecarbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9
Synonyms5430438D01Rik, GalNAc4ST-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.380) question?
Stock #R7801 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location15451924-15760157 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 15452277 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 410 (T410A)
Ref Sequence ENSEMBL: ENSMUSP00000049975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053017] [ENSMUST00000130553]
Predicted Effect probably benign
Transcript: ENSMUST00000053017
AA Change: T410A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000049975
Gene: ENSMUSG00000047161
AA Change: T410A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 68 80 N/A INTRINSIC
Pfam:Sulfotransfer_2 174 409 1.9e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130553
SMART Domains Protein: ENSMUSP00000121484
Gene: ENSMUSG00000047161

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the sulfotransferase 2 family. It is localized to the golgi membrane, and catalyzes the transfer of sulfate to position 4 of non-reducing N-acetylgalactosamine (GalNAc) residues in both N-glycans and O-glycans. Sulfate groups on carbohydrates confer highly specific functions to glycoproteins, glycolipids, and proteoglycans, and are critical for cell-cell interaction, signal transduction, and embryonic development. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A G 1: 89,630,485 Y165C probably damaging Het
Agbl3 A T 6: 34,839,365 T742S probably benign Het
Arhgef10l T C 4: 140,544,267 T651A probably benign Het
Arsb T A 13: 93,862,327 I381N probably damaging Het
Blzf1 A G 1: 164,295,909 V283A probably benign Het
C130060K24Rik T A 6: 65,441,217 V123D probably damaging Het
Cadps C T 14: 12,489,476 probably null Het
Casz1 A T 4: 148,938,249 T591S probably damaging Het
Ccne2 T C 4: 11,194,079 probably null Het
Ciart G A 3: 95,881,344 P61L probably damaging Het
Fam234a T C 17: 26,218,198 D169G probably benign Het
Fat1 C T 8: 45,042,223 P4116L probably damaging Het
Fbxo21 G T 5: 117,986,124 A166S probably damaging Het
Gbf1 A G 19: 46,272,643 I1216V probably benign Het
Gper1 G A 5: 139,426,688 A263T probably benign Het
Hdlbp G T 1: 93,430,307 probably null Het
Ighg3 A T 12: 113,359,816 L280Q Het
Impa1 T C 3: 10,321,667 T171A probably benign Het
Ints7 T A 1: 191,615,747 Y744N possibly damaging Het
Irgc1 G T 7: 24,432,534 A286D probably damaging Het
Kif18a T C 2: 109,287,845 S2P probably damaging Het
Macf1 A T 4: 123,408,271 W813R probably damaging Het
Mapkbp1 T G 2: 120,012,073 H157Q probably damaging Het
Mfsd4b2 T A 10: 39,923,781 M42L probably benign Het
Mon2 A G 10: 123,059,186 probably null Het
Myrfl T A 10: 116,848,335 H161L probably benign Het
Olfr171 T C 16: 19,624,623 H159R probably damaging Het
Olfr832 A C 9: 18,945,259 S204R probably damaging Het
Phlpp2 T G 8: 109,925,842 V606G possibly damaging Het
Psmb5 T C 14: 54,616,755 T89A probably benign Het
Ptpn9 A G 9: 57,061,013 T546A probably benign Het
Rabep2 A G 7: 126,438,412 M146V possibly damaging Het
Rptn G A 3: 93,398,224 E955K possibly damaging Het
Samd3 G T 10: 26,263,872 V301F possibly damaging Het
Sh2b1 C A 7: 126,471,292 C380F probably benign Het
Shank1 A G 7: 44,351,598 M914V unknown Het
Sox2 G A 3: 34,650,642 R76H probably damaging Het
Stat5a T C 11: 100,880,317 F574S probably damaging Het
Tbx5 A G 5: 119,836,999 E29G probably benign Het
Trpm5 A C 7: 143,085,241 D264E probably damaging Het
Zfp442 T C 2: 150,409,719 S88G probably benign Het
Zfp62 T A 11: 49,217,328 F749I possibly damaging Het
Zfp677 T A 17: 21,398,015 S445T probably damaging Het
Zfp979 A C 4: 147,613,978 N91K probably damaging Het
Zfyve9 A G 4: 108,684,995 V209A possibly damaging Het
Zic4 G T 9: 91,384,244 A314S probably benign Het
Other mutations in Chst9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00788:Chst9 APN 18 15453030 missense probably benign 0.34
IGL01910:Chst9 APN 18 15452874 missense possibly damaging 0.90
IGL03038:Chst9 APN 18 15495303 missense probably benign
IGL03146:Chst9 APN 18 15452978 missense probably damaging 1.00
PIT4802001:Chst9 UTSW 18 15452792 missense probably benign 0.01
R0536:Chst9 UTSW 18 15495330 splice site probably benign
R0647:Chst9 UTSW 18 15452669 missense probably damaging 1.00
R1240:Chst9 UTSW 18 15453174 missense probably benign
R1580:Chst9 UTSW 18 15453065 missense probably benign 0.02
R1892:Chst9 UTSW 18 15452960 missense probably damaging 1.00
R2420:Chst9 UTSW 18 15452284 missense probably damaging 1.00
R2446:Chst9 UTSW 18 15452838 missense possibly damaging 0.90
R4737:Chst9 UTSW 18 15452777 missense probably damaging 1.00
R4790:Chst9 UTSW 18 15453050 missense probably damaging 1.00
R4956:Chst9 UTSW 18 15717988 missense probably damaging 1.00
R5202:Chst9 UTSW 18 15453239 missense probably benign 0.02
R5402:Chst9 UTSW 18 15452815 missense probably damaging 0.98
R5754:Chst9 UTSW 18 15453197 missense possibly damaging 0.77
R6035:Chst9 UTSW 18 15452853 missense probably benign 0.13
R6035:Chst9 UTSW 18 15452853 missense probably benign 0.13
R7225:Chst9 UTSW 18 15452661 missense probably damaging 0.99
R7896:Chst9 UTSW 18 15452789 missense probably damaging 1.00
R8159:Chst9 UTSW 18 15452308 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAAGTTGTTTACATGTCTCCTTGAG -3'
(R):5'- AGACCTTAGGAGAGGATGCC -3'

Sequencing Primer
(F):5'- AACTTTGTTCCAATTGCTGTCATAC -3'
(R):5'- GGAGAGGATGCCAATTACTTTCTAC -3'
Posted On2019-11-26