Mutagenetix > Incidental Mutation

Incidental Mutation 'R7801:Gbf1'

600553

Institutional Source

Beutler Lab

Gene Symbol

Gbf1

Ensembl Gene

ENSMUSG00000025224

Gene Name

golgi-specific brefeldin A-resistance factor 1

Synonyms

1700083E03Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7801 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

46152509-46286510 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 46272643 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 1216 (I1216V)

Ref Sequence

ENSEMBL: ENSMUSP00000026254 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026254] [ENSMUST00000176992]

AlphaFold

Q6DFZ1

Predicted Effect

probably benign
Transcript: ENSMUST00000026254
AA Change: I1216V

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000026254
Gene: ENSMUSG00000025224
AA Change: I1216V

Domain	Start	End	E-Value	Type
low complexity region	270	288	N/A	INTRINSIC
Pfam:Sec7_N	400	551	3.4e-29	PFAM
Sec7	696	884	8.55e-91	SMART
low complexity region	1198	1216	N/A	INTRINSIC
low complexity region	1281	1296	N/A	INTRINSIC
low complexity region	1773	1793	N/A	INTRINSIC
low complexity region	1802	1820	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176992
AA Change: I1162V

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000135062
Gene: ENSMUSG00000025224
AA Change: I1162V

Domain	Start	End	E-Value	Type
low complexity region	216	234	N/A	INTRINSIC
Pfam:Sec7_N	343	498	1.5e-35	PFAM
Sec7	642	830	8.55e-91	SMART
low complexity region	1144	1162	N/A	INTRINSIC
low complexity region	1227	1242	N/A	INTRINSIC
low complexity region	1715	1735	N/A	INTRINSIC
low complexity region	1744	1762	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000177512

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Sec7 domain family. The encoded protein is a guanine nucleotide exchange factor that regulates the recruitment of proteins to membranes by mediating GDP to GTP exchange. The encoded protein is localized to the Golgi apparatus and plays a role in vesicular trafficking by activating ADP ribosylation factor 1. The encoded protein has also been identified as an important host factor for viral replication. Multiple transcript variants have been observed for this gene. [provided by RefSeq, Dec 2010]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agap1	A	G	1: 89,630,485	Y165C	probably damaging	Het
Agbl3	A	T	6: 34,839,365	T742S	probably benign	Het
Arhgef10l	T	C	4: 140,544,267	T651A	probably benign	Het
Arsb	T	A	13: 93,862,327	I381N	probably damaging	Het
Blzf1	A	G	1: 164,295,909	V283A	probably benign	Het
C130060K24Rik	T	A	6: 65,441,217	V123D	probably damaging	Het
Cadps	C	T	14: 12,489,476		probably null	Het
Casz1	A	T	4: 148,938,249	T591S	probably damaging	Het
Ccne2	T	C	4: 11,194,079		probably null	Het
Chst9	T	C	18: 15,452,277	T410A	probably benign	Het
Ciart	G	A	3: 95,881,344	P61L	probably damaging	Het
Fam234a	T	C	17: 26,218,198	D169G	probably benign	Het
Fat1	C	T	8: 45,042,223	P4116L	probably damaging	Het
Fbxo21	G	T	5: 117,986,124	A166S	probably damaging	Het
Gper1	G	A	5: 139,426,688	A263T	probably benign	Het
Hdlbp	G	T	1: 93,430,307		probably null	Het
Ighg3	A	T	12: 113,359,816	L280Q		Het
Impa1	T	C	3: 10,321,667	T171A	probably benign	Het
Ints7	T	A	1: 191,615,747	Y744N	possibly damaging	Het
Irgc1	G	T	7: 24,432,534	A286D	probably damaging	Het
Kif18a	T	C	2: 109,287,845	S2P	probably damaging	Het
Macf1	A	T	4: 123,408,271	W813R	probably damaging	Het
Mapkbp1	T	G	2: 120,012,073	H157Q	probably damaging	Het
Mfsd4b2	T	A	10: 39,923,781	M42L	probably benign	Het
Mon2	A	G	10: 123,059,186		probably null	Het
Myrfl	T	A	10: 116,848,335	H161L	probably benign	Het
Olfr171	T	C	16: 19,624,623	H159R	probably damaging	Het
Olfr832	A	C	9: 18,945,259	S204R	probably damaging	Het
Phlpp2	T	G	8: 109,925,842	V606G	possibly damaging	Het
Psmb5	T	C	14: 54,616,755	T89A	probably benign	Het
Ptpn9	A	G	9: 57,061,013	T546A	probably benign	Het
Rabep2	A	G	7: 126,438,412	M146V	possibly damaging	Het
Rptn	G	A	3: 93,398,224	E955K	possibly damaging	Het
Samd3	G	T	10: 26,263,872	V301F	possibly damaging	Het
Sh2b1	C	A	7: 126,471,292	C380F	probably benign	Het
Shank1	A	G	7: 44,351,598	M914V	unknown	Het
Sox2	G	A	3: 34,650,642	R76H	probably damaging	Het
Stat5a	T	C	11: 100,880,317	F574S	probably damaging	Het
Tbx5	A	G	5: 119,836,999	E29G	probably benign	Het
Trpm5	A	C	7: 143,085,241	D264E	probably damaging	Het
Zfp442	T	C	2: 150,409,719	S88G	probably benign	Het
Zfp62	T	A	11: 49,217,328	F749I	possibly damaging	Het
Zfp677	T	A	17: 21,398,015	S445T	probably damaging	Het
Zfp979	A	C	4: 147,613,978	N91K	probably damaging	Het
Zfyve9	A	G	4: 108,684,995	V209A	possibly damaging	Het
Zic4	G	T	9: 91,384,244	A314S	probably benign	Het

Other mutations in Gbf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00585:Gbf1	APN	19	46284249	critical splice acceptor site	probably null
IGL00988:Gbf1	APN	19	46284120	critical splice donor site	probably null
IGL01352:Gbf1	APN	19	46265215	missense	probably damaging	1.00
IGL01432:Gbf1	APN	19	46279995	missense	probably damaging	1.00
IGL01469:Gbf1	APN	19	46279364	missense	probably damaging	1.00
IGL01870:Gbf1	APN	19	46285669	missense	probably benign	0.00
IGL02019:Gbf1	APN	19	46279292	missense	possibly damaging	0.93
IGL02061:Gbf1	APN	19	46279258	missense	possibly damaging	0.65
IGL02126:Gbf1	APN	19	46252117	missense	probably damaging	0.97
IGL02272:Gbf1	APN	19	46269803	missense	probably damaging	1.00
IGL02346:Gbf1	APN	19	46285930	missense	probably damaging	1.00
IGL02491:Gbf1	APN	19	46262540	unclassified	probably benign
IGL03003:Gbf1	APN	19	46255655	missense	probably damaging	1.00
IGL03130:Gbf1	APN	19	46267348	missense	possibly damaging	0.82
IGL03376:Gbf1	APN	19	46262521	missense	possibly damaging	0.94
PIT4651001:Gbf1	UTSW	19	46163543	missense	probably benign
R0107:Gbf1	UTSW	19	46284828	missense	probably benign
R0139:Gbf1	UTSW	19	46261792	missense	probably damaging	1.00
R0180:Gbf1	UTSW	19	46285722	missense	probably benign
R0255:Gbf1	UTSW	19	46254110	splice site	probably benign
R0317:Gbf1	UTSW	19	46254020	missense	probably benign
R0329:Gbf1	UTSW	19	46272270	critical splice donor site	probably null
R0372:Gbf1	UTSW	19	46285704	missense	probably benign
R0666:Gbf1	UTSW	19	46262544	unclassified	probably benign
R1463:Gbf1	UTSW	19	46271545	unclassified	probably benign
R1701:Gbf1	UTSW	19	46261675	missense	probably damaging	1.00
R1848:Gbf1	UTSW	19	46272037	missense	possibly damaging	0.90
R1962:Gbf1	UTSW	19	46267219	missense	probably damaging	1.00
R1965:Gbf1	UTSW	19	46271564	missense	probably damaging	1.00
R1966:Gbf1	UTSW	19	46271564	missense	probably damaging	1.00
R2177:Gbf1	UTSW	19	46265670	missense	probably benign
R2238:Gbf1	UTSW	19	46163618	missense	probably benign
R2239:Gbf1	UTSW	19	46163618	missense	probably benign
R2520:Gbf1	UTSW	19	46265367	missense	probably benign
R3821:Gbf1	UTSW	19	46264807	missense	probably damaging	0.99
R4681:Gbf1	UTSW	19	46280550	missense	probably benign	0.41
R4695:Gbf1	UTSW	19	46259167	nonsense	probably null
R4785:Gbf1	UTSW	19	46268395	missense	possibly damaging	0.89
R5202:Gbf1	UTSW	19	46268454	missense	probably benign	0.13
R5359:Gbf1	UTSW	19	46283725	critical splice donor site	probably null
R5468:Gbf1	UTSW	19	46284296	missense	possibly damaging	0.92
R5593:Gbf1	UTSW	19	46272524	missense	possibly damaging	0.91
R5595:Gbf1	UTSW	19	46284422	missense	possibly damaging	0.74
R5796:Gbf1	UTSW	19	46284343	missense	probably benign	0.08
R5938:Gbf1	UTSW	19	46268452	missense	probably damaging	1.00
R5957:Gbf1	UTSW	19	46246221	critical splice donor site	probably null
R6059:Gbf1	UTSW	19	46265248	missense	probably damaging	1.00
R6120:Gbf1	UTSW	19	46279321	missense	possibly damaging	0.83
R6239:Gbf1	UTSW	19	46259696	missense	probably benign	0.00
R6252:Gbf1	UTSW	19	46271556	missense	probably benign	0.33
R6310:Gbf1	UTSW	19	46280005	missense	probably damaging	0.96
R6787:Gbf1	UTSW	19	46271772	missense	probably benign
R6805:Gbf1	UTSW	19	46262507	missense	probably damaging	1.00
R6855:Gbf1	UTSW	19	46279941	missense	probably benign	0.00
R7313:Gbf1	UTSW	19	46280354	missense	possibly damaging	0.94
R7414:Gbf1	UTSW	19	46283358	nonsense	probably null
R7646:Gbf1	UTSW	19	46283672	missense	probably damaging	1.00
R7650:Gbf1	UTSW	19	46272539	missense	probably damaging	1.00
R7789:Gbf1	UTSW	19	46254002	missense	probably damaging	1.00
R8241:Gbf1	UTSW	19	46246137	missense	probably damaging	1.00
R8716:Gbf1	UTSW	19	46284021	missense	probably damaging	1.00
R8851:Gbf1	UTSW	19	46268483	missense	probably damaging	1.00
R9424:Gbf1	UTSW	19	46259683	missense	probably benign	0.00
R9435:Gbf1	UTSW	19	46279993	missense	probably benign	0.42
R9500:Gbf1	UTSW	19	46269950	missense	probably benign	0.01
R9567:Gbf1	UTSW	19	46271607	missense
R9576:Gbf1	UTSW	19	46259683	missense	probably benign	0.00
R9642:Gbf1	UTSW	19	46270268	missense	probably benign	0.00
R9680:Gbf1	UTSW	19	46283398	missense	probably damaging	0.96
R9760:Gbf1	UTSW	19	46255698	missense	probably benign	0.02
Z1177:Gbf1	UTSW	19	46259142	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GGATAATACCCACCAGCTGTG -3'
(R):5'- CAGTGCCACCTGTGAGATTG -3'

Sequencing Primer
(F):5'- ACCAGCTGTGAAAGGCCTG -3'
(R):5'- GCCACCTGTGAGATTGTACTAGC -3'

Posted On

2019-11-26