Incidental Mutation 'R7802:Mapkapk2'
ID600555
Institutional Source Beutler Lab
Gene Symbol Mapkapk2
Ensembl Gene ENSMUSG00000016528
Gene NameMAP kinase-activated protein kinase 2
SynonymsMAPKAP kinase 2, Rps6kc1, MK2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7802 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location131053700-131097826 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 131056902 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 238 (I238V)
Ref Sequence ENSEMBL: ENSMUSP00000016672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016672] [ENSMUST00000188459]
Predicted Effect possibly damaging
Transcript: ENSMUST00000016672
AA Change: I238V

PolyPhen 2 Score 0.512 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000016672
Gene: ENSMUSG00000016528
AA Change: I238V

DomainStartEndE-ValueType
low complexity region 6 32 N/A INTRINSIC
S_TKc 50 311 1.26e-93 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000188459
AA Change: I159V

PolyPhen 2 Score 0.512 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141124
Gene: ENSMUSG00000016528
AA Change: I159V

DomainStartEndE-ValueType
S_TKc 1 160 4.5e-4 SMART
Meta Mutation Damage Score 0.0699 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ser/Thr protein kinase family. This kinase is regulated through direct phosphorylation by p38 MAP kinase. In conjunction with p38 MAP kinase, this kinase is known to be involved in many cellular processes including stress and inflammatory responses, nuclear export, gene expression regulation and cell proliferation. Heat shock protein HSP27 was shown to be one of the substrates of this kinase in vivo. Two transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Inactivation of this locus affects the inflammatory response. Homozygous null mice show an increased susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
Abl1 T C 2: 31,760,426 V12A probably benign Het
Bahcc1 T C 11: 120,274,692 F983S probably benign Het
Cecr2 T C 6: 120,743,847 I312T probably benign Het
Col6a2 A T 10: 76,603,798 W711R probably damaging Het
Epb41l4a A G 18: 33,828,174 F436L probably benign Het
Epha1 C T 6: 42,361,941 R641Q possibly damaging Het
Ercc6 C A 14: 32,517,303 A116E probably damaging Het
Ermard A G 17: 15,061,161 E611G probably benign Het
Galnt16 T G 12: 80,581,247 I239S probably damaging Het
Gna15 T C 10: 81,514,341 R76G probably benign Het
Herc2 A G 7: 56,164,090 Y2657C probably damaging Het
Med13l T C 5: 118,728,590 S570P probably benign Het
Mettl7a1 A T 15: 100,305,301 N152I possibly damaging Het
Mrap C T 16: 90,749,359 T112M probably benign Het
Nadsyn1 T C 7: 143,806,026 Q403R probably benign Het
Nostrin T C 2: 69,189,012 V467A probably benign Het
Palb2 A T 7: 122,110,896 probably null Het
Parp16 A G 9: 65,229,897 N135S probably benign Het
Pcnt A T 10: 76,375,303 probably null Het
Pde8b T C 13: 95,100,938 D116G probably damaging Het
Psmc5 T C 11: 106,261,712 probably null Het
Rsf1 G T 7: 97,661,772 V570F Het
Rundc3a A G 11: 102,400,009 E306G probably benign Het
Serpinb6b C T 13: 32,971,596 Het
Setx A G 2: 29,147,021 T1173A probably benign Het
Slamf8 A G 1: 172,588,110 S54P probably damaging Het
Slc5a2 A C 7: 128,271,798 D570A possibly damaging Het
Slco5a1 T A 1: 12,990,476 Q7L possibly damaging Het
Stt3b G T 9: 115,276,881 S175R probably damaging Het
Taar6 T A 10: 23,985,253 I132F probably benign Het
Tenm3 A G 8: 48,236,465 V2029A probably damaging Het
Tgm4 A G 9: 123,051,336 probably benign Het
Togaram1 T A 12: 64,966,984 C336* probably null Het
Ttn G A 2: 76,937,671 T3028M unknown Het
Vmn2r25 A T 6: 123,851,832 I161N possibly damaging Het
Vwf T C 6: 125,666,677 C2394R Het
Other mutations in Mapkapk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01503:Mapkapk2 APN 1 131058762 start codon destroyed probably null
R0015:Mapkapk2 UTSW 1 131097326 missense possibly damaging 0.79
R0318:Mapkapk2 UTSW 1 131097335 missense probably damaging 0.99
R1234:Mapkapk2 UTSW 1 131055776 nonsense probably null
R1755:Mapkapk2 UTSW 1 131058350 critical splice donor site probably null
R1765:Mapkapk2 UTSW 1 131058761 start codon destroyed probably null 0.09
R3907:Mapkapk2 UTSW 1 131056914 missense probably damaging 1.00
R5949:Mapkapk2 UTSW 1 131058005 missense possibly damaging 0.95
R6838:Mapkapk2 UTSW 1 131058003 nonsense probably null
R7445:Mapkapk2 UTSW 1 131097519 missense unknown
R7839:Mapkapk2 UTSW 1 131097519 missense unknown
RF002:Mapkapk2 UTSW 1 131056513 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATCAAGTGAAGCAGGAACTC -3'
(R):5'- ATTGCACCCTAAGCTTGTAGC -3'

Sequencing Primer
(F):5'- TCAGAATTCCCAGGGAGCC -3'
(R):5'- GTAGCTGCAGAGTCCCTTCTG -3'
Posted On2019-11-26