Incidental Mutation 'R7802:Slamf8'
ID600556
Institutional Source Beutler Lab
Gene Symbol Slamf8
Ensembl Gene ENSMUSG00000053318
Gene NameSLAM family member 8
Synonyms5830408F06Rik, Blame, SBBI42
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7802 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location172581758-172590568 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 172588110 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 54 (S54P)
Ref Sequence ENSEMBL: ENSMUSP00000067527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065679]
Predicted Effect probably damaging
Transcript: ENSMUST00000065679
AA Change: S54P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000067527
Gene: ENSMUSG00000053318
AA Change: S54P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Blast:IG 28 120 7e-57 BLAST
Blast:IG_like 136 215 3e-35 BLAST
SCOP:d1iray2 143 213 3e-4 SMART
transmembrane domain 234 256 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CD2 family of cell surface proteins involved in lymphocyte activation. These proteins are characterized by Ig domains. This protein is expressed in lymphoid tissues, and studies of a similar protein in mouse suggest that it may function during B cell lineage commitment. The gene is found in a region of chromosome 1 containing many CD2 genes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased Nox2 activity in macrophage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
Abl1 T C 2: 31,760,426 V12A probably benign Het
Bahcc1 T C 11: 120,274,692 F983S probably benign Het
Cecr2 T C 6: 120,743,847 I312T probably benign Het
Col6a2 A T 10: 76,603,798 W711R probably damaging Het
Epb41l4a A G 18: 33,828,174 F436L probably benign Het
Epha1 C T 6: 42,361,941 R641Q possibly damaging Het
Ercc6 C A 14: 32,517,303 A116E probably damaging Het
Ermard A G 17: 15,061,161 E611G probably benign Het
Galnt16 T G 12: 80,581,247 I239S probably damaging Het
Gna15 T C 10: 81,514,341 R76G probably benign Het
Herc2 A G 7: 56,164,090 Y2657C probably damaging Het
Mapkapk2 T C 1: 131,056,902 I238V possibly damaging Het
Med13l T C 5: 118,728,590 S570P probably benign Het
Mettl7a1 A T 15: 100,305,301 N152I possibly damaging Het
Mrap C T 16: 90,749,359 T112M probably benign Het
Nadsyn1 T C 7: 143,806,026 Q403R probably benign Het
Nostrin T C 2: 69,189,012 V467A probably benign Het
Palb2 A T 7: 122,110,896 probably null Het
Parp16 A G 9: 65,229,897 N135S probably benign Het
Pcnt A T 10: 76,375,303 probably null Het
Pde8b T C 13: 95,100,938 D116G probably damaging Het
Psmc5 T C 11: 106,261,712 probably null Het
Rsf1 G T 7: 97,661,772 V570F Het
Rundc3a A G 11: 102,400,009 E306G probably benign Het
Serpinb6b C T 13: 32,971,596 Het
Setx A G 2: 29,147,021 T1173A probably benign Het
Slc5a2 A C 7: 128,271,798 D570A possibly damaging Het
Slco5a1 T A 1: 12,990,476 Q7L possibly damaging Het
Stt3b G T 9: 115,276,881 S175R probably damaging Het
Taar6 T A 10: 23,985,253 I132F probably benign Het
Tenm3 A G 8: 48,236,465 V2029A probably damaging Het
Tgm4 A G 9: 123,051,336 probably benign Het
Togaram1 T A 12: 64,966,984 C336* probably null Het
Ttn G A 2: 76,937,671 T3028M unknown Het
Vmn2r25 A T 6: 123,851,832 I161N possibly damaging Het
Vwf T C 6: 125,666,677 C2394R Het
Other mutations in Slamf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01625:Slamf8 APN 1 172582482 missense probably damaging 1.00
IGL02792:Slamf8 APN 1 172588130 missense probably damaging 1.00
IGL03126:Slamf8 APN 1 172584169 missense possibly damaging 0.73
R1635:Slamf8 UTSW 1 172584619 missense probably damaging 1.00
R1791:Slamf8 UTSW 1 172584520 nonsense probably null
R1792:Slamf8 UTSW 1 172587959 missense possibly damaging 0.71
R4785:Slamf8 UTSW 1 172584214 missense probably damaging 1.00
R6743:Slamf8 UTSW 1 172590398 critical splice donor site probably null
R6974:Slamf8 UTSW 1 172588023 missense probably damaging 1.00
R7222:Slamf8 UTSW 1 172584208 missense possibly damaging 0.73
R7663:Slamf8 UTSW 1 172588038 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CCGTACACCTTGAGATACAGG -3'
(R):5'- ACTCAGCCGTTTGGTTTGC -3'

Sequencing Primer
(F):5'- ATACAGGGTCTGGGTCCAG -3'
(R):5'- CCGTTTGGTTTGCCGGGAG -3'
Posted On2019-11-26