Incidental Mutation 'R7802:Epha1'
ID600563
Institutional Source Beutler Lab
Gene Symbol Epha1
Ensembl Gene ENSMUSG00000029859
Gene NameEph receptor A1
SynonymsEph, 5730453L17Rik, Esk
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R7802 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location42358487-42373268 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 42361941 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 641 (R641Q)
Ref Sequence ENSEMBL: ENSMUSP00000073099 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070635] [ENSMUST00000073387] [ENSMUST00000164375] [ENSMUST00000203401] [ENSMUST00000203652] [ENSMUST00000204357]
PDB Structure
The solution structure of the second fibronectin type III domain of mouse Ephrin type-A receptor 1 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000070635
SMART Domains Protein: ENSMUSP00000070427
Gene: ENSMUSG00000029860

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 21 36 N/A INTRINSIC
low complexity region 61 84 N/A INTRINSIC
low complexity region 92 131 N/A INTRINSIC
low complexity region 144 158 N/A INTRINSIC
low complexity region 174 186 N/A INTRINSIC
low complexity region 199 220 N/A INTRINSIC
low complexity region 250 266 N/A INTRINSIC
low complexity region 269 283 N/A INTRINSIC
low complexity region 323 333 N/A INTRINSIC
low complexity region 343 363 N/A INTRINSIC
LIM 375 428 2.4e-17 SMART
LIM 435 487 7.39e-18 SMART
LIM 495 557 9.31e-15 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000073387
AA Change: R641Q

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000073099
Gene: ENSMUSG00000029859
AA Change: R641Q

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
EPH_lbd 28 205 3.23e-103 SMART
FN3 334 430 8.43e-9 SMART
FN3 448 526 1.59e-4 SMART
Pfam:EphA2_TM 549 622 3.4e-13 PFAM
TyrKc 625 881 2.57e-126 SMART
SAM 911 977 4.13e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164375
SMART Domains Protein: ENSMUSP00000126622
Gene: ENSMUSG00000029860

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 21 36 N/A INTRINSIC
low complexity region 61 84 N/A INTRINSIC
low complexity region 92 131 N/A INTRINSIC
low complexity region 144 158 N/A INTRINSIC
low complexity region 174 186 N/A INTRINSIC
low complexity region 199 220 N/A INTRINSIC
low complexity region 250 266 N/A INTRINSIC
low complexity region 269 283 N/A INTRINSIC
low complexity region 323 333 N/A INTRINSIC
low complexity region 343 363 N/A INTRINSIC
LIM 375 428 2.4e-17 SMART
LIM 435 487 7.39e-18 SMART
LIM 495 557 9.31e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203401
SMART Domains Protein: ENSMUSP00000145236
Gene: ENSMUSG00000029860

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 21 36 N/A INTRINSIC
low complexity region 61 84 N/A INTRINSIC
low complexity region 92 131 N/A INTRINSIC
low complexity region 143 155 N/A INTRINSIC
low complexity region 168 189 N/A INTRINSIC
low complexity region 219 235 N/A INTRINSIC
low complexity region 238 252 N/A INTRINSIC
low complexity region 292 302 N/A INTRINSIC
low complexity region 312 332 N/A INTRINSIC
LIM 344 397 2.4e-17 SMART
LIM 404 456 7.39e-18 SMART
LIM 464 526 9.31e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203652
SMART Domains Protein: ENSMUSP00000145451
Gene: ENSMUSG00000029860

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 21 36 N/A INTRINSIC
low complexity region 61 84 N/A INTRINSIC
low complexity region 92 131 N/A INTRINSIC
low complexity region 144 158 N/A INTRINSIC
low complexity region 174 186 N/A INTRINSIC
low complexity region 199 220 N/A INTRINSIC
low complexity region 250 266 N/A INTRINSIC
low complexity region 269 283 N/A INTRINSIC
low complexity region 323 333 N/A INTRINSIC
low complexity region 343 363 N/A INTRINSIC
LIM 375 428 2.4e-17 SMART
LIM 435 487 7.39e-18 SMART
LIM 495 557 9.31e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204357
AA Change: R678Q

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000144763
Gene: ENSMUSG00000029859
AA Change: R678Q

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
EPH_lbd 28 205 1.1e-105 SMART
FN3 334 430 4.2e-11 SMART
low complexity region 459 473 N/A INTRINSIC
FN3 483 563 2.4e-8 SMART
Pfam:EphA2_TM 586 659 7.6e-11 PFAM
STYKc 662 849 1.1e-65 SMART
SAM 879 945 2.5e-21 SMART
Meta Mutation Damage Score 0.1930 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. This gene is expressed in some human cancer cell lines and has been implicated in carcinogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most mice homozygous for a null allele exhibit a kinked tail while 18% of mice exhibit vagina atresia with hydrometrocolops and infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
Abl1 T C 2: 31,760,426 V12A probably benign Het
Bahcc1 T C 11: 120,274,692 F983S probably benign Het
Cecr2 T C 6: 120,743,847 I312T probably benign Het
Col6a2 A T 10: 76,603,798 W711R probably damaging Het
Epb41l4a A G 18: 33,828,174 F436L probably benign Het
Ercc6 C A 14: 32,517,303 A116E probably damaging Het
Ermard A G 17: 15,061,161 E611G probably benign Het
Galnt16 T G 12: 80,581,247 I239S probably damaging Het
Gna15 T C 10: 81,514,341 R76G probably benign Het
Herc2 A G 7: 56,164,090 Y2657C probably damaging Het
Mapkapk2 T C 1: 131,056,902 I238V possibly damaging Het
Med13l T C 5: 118,728,590 S570P probably benign Het
Mettl7a1 A T 15: 100,305,301 N152I possibly damaging Het
Mrap C T 16: 90,749,359 T112M probably benign Het
Nadsyn1 T C 7: 143,806,026 Q403R probably benign Het
Nostrin T C 2: 69,189,012 V467A probably benign Het
Palb2 A T 7: 122,110,896 probably null Het
Parp16 A G 9: 65,229,897 N135S probably benign Het
Pcnt A T 10: 76,375,303 probably null Het
Pde8b T C 13: 95,100,938 D116G probably damaging Het
Psmc5 T C 11: 106,261,712 probably null Het
Rsf1 G T 7: 97,661,772 V570F Het
Rundc3a A G 11: 102,400,009 E306G probably benign Het
Serpinb6b C T 13: 32,971,596 Het
Setx A G 2: 29,147,021 T1173A probably benign Het
Slamf8 A G 1: 172,588,110 S54P probably damaging Het
Slc5a2 A C 7: 128,271,798 D570A possibly damaging Het
Slco5a1 T A 1: 12,990,476 Q7L possibly damaging Het
Stt3b G T 9: 115,276,881 S175R probably damaging Het
Taar6 T A 10: 23,985,253 I132F probably benign Het
Tenm3 A G 8: 48,236,465 V2029A probably damaging Het
Tgm4 A G 9: 123,051,336 probably benign Het
Togaram1 T A 12: 64,966,984 C336* probably null Het
Ttn G A 2: 76,937,671 T3028M unknown Het
Vmn2r25 A T 6: 123,851,832 I161N possibly damaging Het
Vwf T C 6: 125,666,677 C2394R Het
Other mutations in Epha1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01591:Epha1 APN 6 42360551 missense probably damaging 1.00
IGL02388:Epha1 APN 6 42365016 missense probably damaging 1.00
IGL02614:Epha1 APN 6 42360557 missense probably benign 0.02
IGL03019:Epha1 APN 6 42362752 missense probably damaging 1.00
buddy UTSW 6 42361451 missense probably damaging 1.00
R0369:Epha1 UTSW 6 42365473 missense probably damaging 1.00
R0894:Epha1 UTSW 6 42363822 missense probably benign 0.45
R1353:Epha1 UTSW 6 42361837 missense probably damaging 0.99
R1451:Epha1 UTSW 6 42361451 missense probably damaging 1.00
R1840:Epha1 UTSW 6 42363588 missense probably damaging 0.99
R2064:Epha1 UTSW 6 42366053 missense probably benign 0.01
R2065:Epha1 UTSW 6 42366053 missense probably benign 0.01
R2067:Epha1 UTSW 6 42366053 missense probably benign 0.01
R2087:Epha1 UTSW 6 42363568 missense probably benign 0.01
R3691:Epha1 UTSW 6 42361130 missense probably damaging 1.00
R3952:Epha1 UTSW 6 42364285 missense probably damaging 0.99
R4111:Epha1 UTSW 6 42358838 missense possibly damaging 0.88
R4280:Epha1 UTSW 6 42365052 missense probably damaging 1.00
R4369:Epha1 UTSW 6 42365457 missense probably damaging 1.00
R4371:Epha1 UTSW 6 42365457 missense probably damaging 1.00
R4491:Epha1 UTSW 6 42360666 missense probably damaging 1.00
R4743:Epha1 UTSW 6 42372221 missense probably benign 0.00
R4838:Epha1 UTSW 6 42363816 missense probably benign 0.04
R4847:Epha1 UTSW 6 42361914 missense possibly damaging 0.88
R4857:Epha1 UTSW 6 42361482 missense probably benign 0.00
R4884:Epha1 UTSW 6 42360734 missense probably damaging 0.99
R4929:Epha1 UTSW 6 42364599 missense probably benign 0.05
R5239:Epha1 UTSW 6 42365010 missense possibly damaging 0.87
R5416:Epha1 UTSW 6 42365871 missense probably damaging 1.00
R5595:Epha1 UTSW 6 42364634 missense possibly damaging 0.78
R5838:Epha1 UTSW 6 42361646 missense probably damaging 1.00
R6395:Epha1 UTSW 6 42366172 missense probably damaging 1.00
R6594:Epha1 UTSW 6 42364691 missense probably benign
R6639:Epha1 UTSW 6 42365935 nonsense probably null
R7092:Epha1 UTSW 6 42364245 missense probably benign 0.36
R7569:Epha1 UTSW 6 42365422 missense possibly damaging 0.70
R7705:Epha1 UTSW 6 42362668 missense probably damaging 0.99
R8306:Epha1 UTSW 6 42358788 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCACACTCAGACCCAGGTTTCC -3'
(R):5'- ACATAAGCCAAGGAGCATGC -3'

Sequencing Primer
(F):5'- GGGACCAATGCACATACTTTTTGTG -3'
(R):5'- CATGCTAGCCATGGAAGACAGTAC -3'
Posted On2019-11-26