Incidental Mutation 'R7802:Vmn2r25'
ID600565
Institutional Source Beutler Lab
Gene Symbol Vmn2r25
Ensembl Gene ENSMUSG00000094672
Gene Namevomeronasal 2, receptor 25
SynonymsEG545874
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R7802 (G1)
Quality Score210.009
Status Validated
Chromosome6
Chromosomal Location123822814-123853190 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 123851832 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 161 (I161N)
Ref Sequence ENSEMBL: ENSMUSP00000124342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000162046]
Predicted Effect possibly damaging
Transcript: ENSMUST00000162046
AA Change: I161N

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124342
Gene: ENSMUSG00000094672
AA Change: I161N

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 82 473 6e-31 PFAM
Pfam:NCD3G 519 572 5.8e-25 PFAM
Pfam:7tm_3 603 840 4.8e-55 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
Abl1 T C 2: 31,760,426 V12A probably benign Het
Bahcc1 T C 11: 120,274,692 F983S probably benign Het
Cecr2 T C 6: 120,743,847 I312T probably benign Het
Col6a2 A T 10: 76,603,798 W711R probably damaging Het
Epb41l4a A G 18: 33,828,174 F436L probably benign Het
Epha1 C T 6: 42,361,941 R641Q possibly damaging Het
Ercc6 C A 14: 32,517,303 A116E probably damaging Het
Ermard A G 17: 15,061,161 E611G probably benign Het
Galnt16 T G 12: 80,581,247 I239S probably damaging Het
Gna15 T C 10: 81,514,341 R76G probably benign Het
Herc2 A G 7: 56,164,090 Y2657C probably damaging Het
Mapkapk2 T C 1: 131,056,902 I238V possibly damaging Het
Med13l T C 5: 118,728,590 S570P probably benign Het
Mettl7a1 A T 15: 100,305,301 N152I possibly damaging Het
Mrap C T 16: 90,749,359 T112M probably benign Het
Nadsyn1 T C 7: 143,806,026 Q403R probably benign Het
Nostrin T C 2: 69,189,012 V467A probably benign Het
Palb2 A T 7: 122,110,896 probably null Het
Parp16 A G 9: 65,229,897 N135S probably benign Het
Pcnt A T 10: 76,375,303 probably null Het
Pde8b T C 13: 95,100,938 D116G probably damaging Het
Psmc5 T C 11: 106,261,712 probably null Het
Rsf1 G T 7: 97,661,772 V570F Het
Rundc3a A G 11: 102,400,009 E306G probably benign Het
Serpinb6b C T 13: 32,971,596 Het
Setx A G 2: 29,147,021 T1173A probably benign Het
Slamf8 A G 1: 172,588,110 S54P probably damaging Het
Slc5a2 A C 7: 128,271,798 D570A possibly damaging Het
Slco5a1 T A 1: 12,990,476 Q7L possibly damaging Het
Stt3b G T 9: 115,276,881 S175R probably damaging Het
Taar6 T A 10: 23,985,253 I132F probably benign Het
Tenm3 A G 8: 48,236,465 V2029A probably damaging Het
Tgm4 A G 9: 123,051,336 probably benign Het
Togaram1 T A 12: 64,966,984 C336* probably null Het
Ttn G A 2: 76,937,671 T3028M unknown Het
Vwf T C 6: 125,666,677 C2394R Het
Other mutations in Vmn2r25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Vmn2r25 APN 6 123853171 missense probably benign 0.25
IGL01781:Vmn2r25 APN 6 123839365 missense possibly damaging 0.48
IGL01843:Vmn2r25 APN 6 123853003 missense possibly damaging 0.67
IGL02023:Vmn2r25 APN 6 123839429 missense probably damaging 0.96
IGL02502:Vmn2r25 APN 6 123839433 missense probably damaging 0.96
IGL02709:Vmn2r25 APN 6 123839764 missense possibly damaging 0.50
IGL03053:Vmn2r25 APN 6 123823118 missense probably damaging 1.00
PIT4468001:Vmn2r25 UTSW 6 123839598 missense probably benign 0.00
PIT4812001:Vmn2r25 UTSW 6 123823488 missense probably damaging 1.00
R0054:Vmn2r25 UTSW 6 123853025 missense probably benign 0.00
R0312:Vmn2r25 UTSW 6 123828580 splice site probably benign
R0366:Vmn2r25 UTSW 6 123823622 nonsense probably null
R0390:Vmn2r25 UTSW 6 123823181 missense probably damaging 1.00
R0466:Vmn2r25 UTSW 6 123852049 missense probably benign 0.16
R0541:Vmn2r25 UTSW 6 123839827 missense probably damaging 0.97
R0612:Vmn2r25 UTSW 6 123839522 missense probably damaging 1.00
R0865:Vmn2r25 UTSW 6 123853017 missense probably benign 0.09
R1219:Vmn2r25 UTSW 6 123839323 missense probably benign 0.00
R1240:Vmn2r25 UTSW 6 123851905 missense probably damaging 0.98
R1701:Vmn2r25 UTSW 6 123851795 splice site probably null
R1780:Vmn2r25 UTSW 6 123828465 missense probably damaging 1.00
R1809:Vmn2r25 UTSW 6 123825378 missense probably benign 0.00
R1833:Vmn2r25 UTSW 6 123839684 missense probably benign 0.01
R1964:Vmn2r25 UTSW 6 123823295 missense possibly damaging 0.94
R2154:Vmn2r25 UTSW 6 123839846 missense probably benign 0.01
R2164:Vmn2r25 UTSW 6 123839559 missense possibly damaging 0.96
R3799:Vmn2r25 UTSW 6 123853184 missense probably benign 0.12
R3836:Vmn2r25 UTSW 6 123853085 missense probably damaging 1.00
R3946:Vmn2r25 UTSW 6 123840098 missense probably damaging 0.97
R4282:Vmn2r25 UTSW 6 123823647 missense probably damaging 1.00
R4367:Vmn2r25 UTSW 6 123828537 missense probably damaging 1.00
R4438:Vmn2r25 UTSW 6 123839797 missense probably benign 0.03
R4488:Vmn2r25 UTSW 6 123822860 missense probably damaging 1.00
R4580:Vmn2r25 UTSW 6 123823023 missense possibly damaging 0.46
R4631:Vmn2r25 UTSW 6 123853003 missense possibly damaging 0.94
R4765:Vmn2r25 UTSW 6 123823223 missense probably damaging 1.00
R4908:Vmn2r25 UTSW 6 123828447 missense probably benign
R5207:Vmn2r25 UTSW 6 123840103 missense probably damaging 1.00
R5254:Vmn2r25 UTSW 6 123825318 missense probably damaging 1.00
R5444:Vmn2r25 UTSW 6 123828492 missense probably benign 0.00
R5586:Vmn2r25 UTSW 6 123825296 missense probably damaging 1.00
R5607:Vmn2r25 UTSW 6 123828359 missense possibly damaging 0.49
R5985:Vmn2r25 UTSW 6 123823628 missense probably benign
R6046:Vmn2r25 UTSW 6 123822917 missense probably damaging 1.00
R6057:Vmn2r25 UTSW 6 123822941 missense possibly damaging 0.69
R6569:Vmn2r25 UTSW 6 123851982 missense probably benign 0.01
R6826:Vmn2r25 UTSW 6 123823112 missense probably damaging 1.00
R7054:Vmn2r25 UTSW 6 123823610 missense probably damaging 1.00
R7120:Vmn2r25 UTSW 6 123828435 missense possibly damaging 0.51
R7177:Vmn2r25 UTSW 6 123839923 missense possibly damaging 0.94
R7287:Vmn2r25 UTSW 6 123852081 missense possibly damaging 0.49
R7397:Vmn2r25 UTSW 6 123823539 missense probably damaging 0.96
R7486:Vmn2r25 UTSW 6 123823142 missense probably damaging 1.00
R7699:Vmn2r25 UTSW 6 123839923 missense possibly damaging 0.94
R7700:Vmn2r25 UTSW 6 123839923 missense possibly damaging 0.94
R7759:Vmn2r25 UTSW 6 123823380 missense probably damaging 0.99
R7850:Vmn2r25 UTSW 6 123828472 missense probably damaging 1.00
R8064:Vmn2r25 UTSW 6 123823622 nonsense probably null
R8170:Vmn2r25 UTSW 6 123853017 missense probably benign 0.09
R8340:Vmn2r25 UTSW 6 123853013 missense probably benign 0.01
R8346:Vmn2r25 UTSW 6 123825391 missense probably benign 0.00
R8395:Vmn2r25 UTSW 6 123823023 missense possibly damaging 0.81
X0020:Vmn2r25 UTSW 6 123839400 missense possibly damaging 0.95
Z1176:Vmn2r25 UTSW 6 123822897 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGGGCTACATAGGAAGTTC -3'
(R):5'- AATAAGTCCCTGGGATTCTTTCTC -3'

Sequencing Primer
(F):5'- GTGGGCTACATAGGAAGTTCAATATC -3'
(R):5'- GGGATTCTTTCTCTTCAATGTCAAC -3'
Posted On2019-11-26