Incidental Mutation 'R7802:Slc5a2'
ID600569
Institutional Source Beutler Lab
Gene Symbol Slc5a2
Ensembl Gene ENSMUSG00000030781
Gene Namesolute carrier family 5 (sodium/glucose cotransporter), member 2
SynonymsSglt2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7802 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location128265657-128272430 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 128271798 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 570 (D570A)
Ref Sequence ENSEMBL: ENSMUSP00000112597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033044] [ENSMUST00000033045] [ENSMUST00000118169] [ENSMUST00000126263] [ENSMUST00000137038] [ENSMUST00000142841] [ENSMUST00000153418] [ENSMUST00000205720] [ENSMUST00000206909]
Predicted Effect probably benign
Transcript: ENSMUST00000033044
SMART Domains Protein: ENSMUSP00000033044
Gene: ENSMUSG00000030780

DomainStartEndE-ValueType
Pfam:DUF647 62 301 5.6e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000033045
Predicted Effect possibly damaging
Transcript: ENSMUST00000118169
AA Change: D570A

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112597
Gene: ENSMUSG00000030781
AA Change: D570A

DomainStartEndE-ValueType
Pfam:SSF 53 490 7e-170 PFAM
transmembrane domain 524 546 N/A INTRINSIC
low complexity region 566 577 N/A INTRINSIC
low complexity region 615 635 N/A INTRINSIC
transmembrane domain 650 669 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126263
SMART Domains Protein: ENSMUSP00000114673
Gene: ENSMUSG00000030780

DomainStartEndE-ValueType
Pfam:DUF647 61 304 3e-102 PFAM
low complexity region 334 347 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137038
SMART Domains Protein: ENSMUSP00000124318
Gene: ENSMUSG00000030781

DomainStartEndE-ValueType
Pfam:SSF 1 103 3.3e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142841
SMART Domains Protein: ENSMUSP00000115451
Gene: ENSMUSG00000030781

DomainStartEndE-ValueType
Pfam:SSF 53 276 5.7e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153418
Predicted Effect silent
Transcript: ENSMUST00000205720
Predicted Effect silent
Transcript: ENSMUST00000206703
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000206909
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium glucose cotransporter family which are sodium-dependent glucose transport proteins. The encoded protein is the major cotransporter involved in glucose reabsorption in the kidney. Mutations in this gene are associated with renal glucosuria. Two transcript variants, one protein-coding and one not, have been found for this gene. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit increased urine glucose, increased eating and drinking behaviors, increased circulating renin activity, decreased urine osmolality, decreased serum aldosterone levels, polyuria, and decreased glucose renal reabsorption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
Abl1 T C 2: 31,760,426 V12A probably benign Het
Bahcc1 T C 11: 120,274,692 F983S probably benign Het
Cecr2 T C 6: 120,743,847 I312T probably benign Het
Col6a2 A T 10: 76,603,798 W711R probably damaging Het
Epb41l4a A G 18: 33,828,174 F436L probably benign Het
Epha1 C T 6: 42,361,941 R641Q possibly damaging Het
Ercc6 C A 14: 32,517,303 A116E probably damaging Het
Ermard A G 17: 15,061,161 E611G probably benign Het
Galnt16 T G 12: 80,581,247 I239S probably damaging Het
Gna15 T C 10: 81,514,341 R76G probably benign Het
Herc2 A G 7: 56,164,090 Y2657C probably damaging Het
Mapkapk2 T C 1: 131,056,902 I238V possibly damaging Het
Med13l T C 5: 118,728,590 S570P probably benign Het
Mettl7a1 A T 15: 100,305,301 N152I possibly damaging Het
Mrap C T 16: 90,749,359 T112M probably benign Het
Nadsyn1 T C 7: 143,806,026 Q403R probably benign Het
Nostrin T C 2: 69,189,012 V467A probably benign Het
Palb2 A T 7: 122,110,896 probably null Het
Parp16 A G 9: 65,229,897 N135S probably benign Het
Pcnt A T 10: 76,375,303 probably null Het
Pde8b T C 13: 95,100,938 D116G probably damaging Het
Psmc5 T C 11: 106,261,712 probably null Het
Rsf1 G T 7: 97,661,772 V570F Het
Rundc3a A G 11: 102,400,009 E306G probably benign Het
Serpinb6b C T 13: 32,971,596 Het
Setx A G 2: 29,147,021 T1173A probably benign Het
Slamf8 A G 1: 172,588,110 S54P probably damaging Het
Slco5a1 T A 1: 12,990,476 Q7L possibly damaging Het
Stt3b G T 9: 115,276,881 S175R probably damaging Het
Taar6 T A 10: 23,985,253 I132F probably benign Het
Tenm3 A G 8: 48,236,465 V2029A probably damaging Het
Tgm4 A G 9: 123,051,336 probably benign Het
Togaram1 T A 12: 64,966,984 C336* probably null Het
Ttn G A 2: 76,937,671 T3028M unknown Het
Vmn2r25 A T 6: 123,851,832 I161N possibly damaging Het
Vwf T C 6: 125,666,677 C2394R Het
Other mutations in Slc5a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01511:Slc5a2 APN 7 128270622 missense probably benign 0.07
IGL03084:Slc5a2 APN 7 128266604 missense probably benign 0.25
dregs UTSW 7 128267505 splice site probably null
jimbee UTSW 7 large deletion
R0026:Slc5a2 UTSW 7 128270053 missense probably damaging 1.00
R0395:Slc5a2 UTSW 7 128267482 missense probably damaging 1.00
R0544:Slc5a2 UTSW 7 128269999 missense probably damaging 1.00
R0762:Slc5a2 UTSW 7 128267482 missense probably damaging 1.00
R0966:Slc5a2 UTSW 7 128270631 missense probably damaging 1.00
R0968:Slc5a2 UTSW 7 128270631 missense probably damaging 1.00
R1382:Slc5a2 UTSW 7 128270631 missense probably damaging 1.00
R1383:Slc5a2 UTSW 7 128270631 missense probably damaging 1.00
R1385:Slc5a2 UTSW 7 128270631 missense probably damaging 1.00
R1467:Slc5a2 UTSW 7 128271256 unclassified probably benign
R4836:Slc5a2 UTSW 7 128267505 splice site probably null
R4983:Slc5a2 UTSW 7 128271810 makesense probably null
R5703:Slc5a2 UTSW 7 128270615 missense possibly damaging 0.77
R6185:Slc5a2 UTSW 7 128271177 missense probably damaging 0.98
R6696:Slc5a2 UTSW 7 128270043 missense probably damaging 1.00
R6969:Slc5a2 UTSW 7 128272077 missense probably benign 0.00
R7062:Slc5a2 UTSW 7 128270040 missense probably damaging 0.99
R7576:Slc5a2 UTSW 7 128265805 missense probably damaging 1.00
R7747:Slc5a2 UTSW 7 128266395 synonymous probably null
R7915:Slc5a2 UTSW 7 128265794 missense probably damaging 0.96
R8027:Slc5a2 UTSW 7 128270546 missense probably damaging 1.00
R8194:Slc5a2 UTSW 7 128271156 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TGAAGGCAAAGACTGTCCTGG -3'
(R):5'- TCTTGCTCATCCCACAGAAC -3'

Sequencing Primer
(F):5'- CTGTCCTGGAAAGAGGAGTCTG -3'
(R):5'- GAACCAAAGCAGGCACCGG -3'
Posted On2019-11-26