Incidental Mutation 'R7802:Nadsyn1'
ID600570
Institutional Source Beutler Lab
Gene Symbol Nadsyn1
Ensembl Gene ENSMUSG00000031090
Gene NameNAD synthetase 1
Synonyms9130012B15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7802 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location143795584-143822849 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 143806026 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 403 (Q403R)
Ref Sequence ENSEMBL: ENSMUSP00000033415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033415] [ENSMUST00000132520] [ENSMUST00000156638]
Predicted Effect probably benign
Transcript: ENSMUST00000033415
AA Change: Q403R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000033415
Gene: ENSMUSG00000031090
AA Change: Q403R

DomainStartEndE-ValueType
Pfam:CN_hydrolase 6 283 3.2e-52 PFAM
Pfam:NAD_synthase 337 649 3.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132520
AA Change: Q403R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000114380
Gene: ENSMUSG00000031090
AA Change: Q403R

DomainStartEndE-ValueType
Pfam:CN_hydrolase 6 201 6.3e-39 PFAM
Pfam:NAD_synthase 336 561 8.6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156638
SMART Domains Protein: ENSMUSP00000114889
Gene: ENSMUSG00000031090

DomainStartEndE-ValueType
SCOP:d1f89a_ 1 28 1e-4 SMART
Meta Mutation Damage Score 0.0740 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nicotinamide adenine dinucleotide (NAD) is a coenzyme in metabolic redox reactions, a precursor for several cell signaling molecules, and a substrate for protein posttranslational modifications. NAD synthetase (EC 6.3.5.1) catalyzes the final step in the biosynthesis of NAD from nicotinic acid adenine dinucleotide (NaAD).[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
Abl1 T C 2: 31,760,426 V12A probably benign Het
Bahcc1 T C 11: 120,274,692 F983S probably benign Het
Cecr2 T C 6: 120,743,847 I312T probably benign Het
Col6a2 A T 10: 76,603,798 W711R probably damaging Het
Epb41l4a A G 18: 33,828,174 F436L probably benign Het
Epha1 C T 6: 42,361,941 R641Q possibly damaging Het
Ercc6 C A 14: 32,517,303 A116E probably damaging Het
Ermard A G 17: 15,061,161 E611G probably benign Het
Galnt16 T G 12: 80,581,247 I239S probably damaging Het
Gna15 T C 10: 81,514,341 R76G probably benign Het
Herc2 A G 7: 56,164,090 Y2657C probably damaging Het
Mapkapk2 T C 1: 131,056,902 I238V possibly damaging Het
Med13l T C 5: 118,728,590 S570P probably benign Het
Mettl7a1 A T 15: 100,305,301 N152I possibly damaging Het
Mrap C T 16: 90,749,359 T112M probably benign Het
Nostrin T C 2: 69,189,012 V467A probably benign Het
Palb2 A T 7: 122,110,896 probably null Het
Parp16 A G 9: 65,229,897 N135S probably benign Het
Pcnt A T 10: 76,375,303 probably null Het
Pde8b T C 13: 95,100,938 D116G probably damaging Het
Psmc5 T C 11: 106,261,712 probably null Het
Rsf1 G T 7: 97,661,772 V570F Het
Rundc3a A G 11: 102,400,009 E306G probably benign Het
Serpinb6b C T 13: 32,971,596 Het
Setx A G 2: 29,147,021 T1173A probably benign Het
Slamf8 A G 1: 172,588,110 S54P probably damaging Het
Slc5a2 A C 7: 128,271,798 D570A possibly damaging Het
Slco5a1 T A 1: 12,990,476 Q7L possibly damaging Het
Stt3b G T 9: 115,276,881 S175R probably damaging Het
Taar6 T A 10: 23,985,253 I132F probably benign Het
Tenm3 A G 8: 48,236,465 V2029A probably damaging Het
Tgm4 A G 9: 123,051,336 probably benign Het
Togaram1 T A 12: 64,966,984 C336* probably null Het
Ttn G A 2: 76,937,671 T3028M unknown Het
Vmn2r25 A T 6: 123,851,832 I161N possibly damaging Het
Vwf T C 6: 125,666,677 C2394R Het
Other mutations in Nadsyn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Nadsyn1 APN 7 143812793 missense probably damaging 1.00
IGL01359:Nadsyn1 APN 7 143821230 missense possibly damaging 0.74
IGL01412:Nadsyn1 APN 7 143808790 critical splice donor site probably null
IGL01481:Nadsyn1 APN 7 143812584 missense probably damaging 1.00
IGL01642:Nadsyn1 APN 7 143797878 missense probably damaging 1.00
IGL02110:Nadsyn1 APN 7 143813427 missense probably damaging 1.00
IGL02126:Nadsyn1 APN 7 143804016 nonsense probably null
IGL02173:Nadsyn1 APN 7 143804006 splice site probably benign
IGL02351:Nadsyn1 APN 7 143799912 missense probably damaging 1.00
IGL02358:Nadsyn1 APN 7 143799912 missense probably damaging 1.00
IGL03216:Nadsyn1 APN 7 143797845 missense probably damaging 1.00
R0029:Nadsyn1 UTSW 7 143806078 missense probably benign 0.01
R0036:Nadsyn1 UTSW 7 143811291 missense probably benign 0.23
R0968:Nadsyn1 UTSW 7 143806033 missense probably benign 0.30
R1487:Nadsyn1 UTSW 7 143806925 missense probably benign 0.31
R1694:Nadsyn1 UTSW 7 143808012 missense probably benign 0.00
R1874:Nadsyn1 UTSW 7 143797844 missense probably damaging 1.00
R4540:Nadsyn1 UTSW 7 143803223 missense probably damaging 1.00
R4742:Nadsyn1 UTSW 7 143798630 intron probably benign
R4755:Nadsyn1 UTSW 7 143806913 missense probably damaging 1.00
R5045:Nadsyn1 UTSW 7 143806969 missense probably damaging 1.00
R5288:Nadsyn1 UTSW 7 143803286 missense possibly damaging 0.95
R5326:Nadsyn1 UTSW 7 143808830 missense probably benign 0.42
R5666:Nadsyn1 UTSW 7 143807431 missense probably damaging 1.00
R5669:Nadsyn1 UTSW 7 143807431 missense probably damaging 1.00
R5691:Nadsyn1 UTSW 7 143812579 unclassified probably null
R5861:Nadsyn1 UTSW 7 143811227 missense possibly damaging 0.80
R6213:Nadsyn1 UTSW 7 143799812 missense probably benign 0.05
R6624:Nadsyn1 UTSW 7 143805973 missense probably benign 0.02
R6652:Nadsyn1 UTSW 7 143811218 missense probably benign 0.03
R6791:Nadsyn1 UTSW 7 143819108 missense probably damaging 1.00
R7144:Nadsyn1 UTSW 7 143811215 missense probably damaging 0.99
R7559:Nadsyn1 UTSW 7 143808067 missense probably benign 0.00
R7770:Nadsyn1 UTSW 7 143806003 missense probably damaging 1.00
R7871:Nadsyn1 UTSW 7 143798496 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGCTCTGACCTTTGCCATG -3'
(R):5'- CCAGAGTTAACGTGTGGGAG -3'

Sequencing Primer
(F):5'- ATGGTGCCAGCCTGAACTCAG -3'
(R):5'- CTTAGGATCAGACCGGGGTAC -3'
Posted On2019-11-26