Incidental Mutation 'R7802:Taar6'
ID600574
Institutional Source Beutler Lab
Gene Symbol Taar6
Ensembl Gene ENSMUSG00000045111
Gene Nametrace amine-associated receptor 6
SynonymsLOC215855
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.268) question?
Stock #R7802 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location23984609-23985646 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 23985253 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 132 (I132F)
Ref Sequence ENSEMBL: ENSMUSP00000097603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057080]
Predicted Effect probably benign
Transcript: ENSMUST00000057080
AA Change: I132F

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000097603
Gene: ENSMUSG00000045111
AA Change: I132F

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 43 326 5.5e-13 PFAM
Pfam:7tm_1 49 311 5.9e-58 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a seven-transmembrane G-protein-coupled receptor that likely functions as a receptor for endogenous trace amines. Mutations in this gene may be associated with schizophrenia.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
Abl1 T C 2: 31,760,426 V12A probably benign Het
Bahcc1 T C 11: 120,274,692 F983S probably benign Het
Cecr2 T C 6: 120,743,847 I312T probably benign Het
Col6a2 A T 10: 76,603,798 W711R probably damaging Het
Epb41l4a A G 18: 33,828,174 F436L probably benign Het
Epha1 C T 6: 42,361,941 R641Q possibly damaging Het
Ercc6 C A 14: 32,517,303 A116E probably damaging Het
Ermard A G 17: 15,061,161 E611G probably benign Het
Galnt16 T G 12: 80,581,247 I239S probably damaging Het
Gna15 T C 10: 81,514,341 R76G probably benign Het
Herc2 A G 7: 56,164,090 Y2657C probably damaging Het
Mapkapk2 T C 1: 131,056,902 I238V possibly damaging Het
Med13l T C 5: 118,728,590 S570P probably benign Het
Mettl7a1 A T 15: 100,305,301 N152I possibly damaging Het
Mrap C T 16: 90,749,359 T112M probably benign Het
Nadsyn1 T C 7: 143,806,026 Q403R probably benign Het
Nostrin T C 2: 69,189,012 V467A probably benign Het
Palb2 A T 7: 122,110,896 probably null Het
Parp16 A G 9: 65,229,897 N135S probably benign Het
Pcnt A T 10: 76,375,303 probably null Het
Pde8b T C 13: 95,100,938 D116G probably damaging Het
Psmc5 T C 11: 106,261,712 probably null Het
Rsf1 G T 7: 97,661,772 V570F Het
Rundc3a A G 11: 102,400,009 E306G probably benign Het
Serpinb6b C T 13: 32,971,596 Het
Setx A G 2: 29,147,021 T1173A probably benign Het
Slamf8 A G 1: 172,588,110 S54P probably damaging Het
Slc5a2 A C 7: 128,271,798 D570A possibly damaging Het
Slco5a1 T A 1: 12,990,476 Q7L possibly damaging Het
Stt3b G T 9: 115,276,881 S175R probably damaging Het
Tenm3 A G 8: 48,236,465 V2029A probably damaging Het
Tgm4 A G 9: 123,051,336 probably benign Het
Togaram1 T A 12: 64,966,984 C336* probably null Het
Ttn G A 2: 76,937,671 T3028M unknown Het
Vmn2r25 A T 6: 123,851,832 I161N possibly damaging Het
Vwf T C 6: 125,666,677 C2394R Het
Other mutations in Taar6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00648:Taar6 APN 10 23985508 missense probably benign 0.15
IGL00918:Taar6 APN 10 23985582 missense probably damaging 1.00
IGL01060:Taar6 APN 10 23985072 missense probably benign
IGL02608:Taar6 APN 10 23985183 missense probably benign 0.01
R0042:Taar6 UTSW 10 23985123 missense probably benign 0.36
R0042:Taar6 UTSW 10 23985123 missense probably benign 0.36
R0360:Taar6 UTSW 10 23985148 missense probably benign 0.01
R0364:Taar6 UTSW 10 23985148 missense probably benign 0.01
R0746:Taar6 UTSW 10 23985360 missense probably benign 0.43
R1637:Taar6 UTSW 10 23985181 missense probably benign 0.12
R4893:Taar6 UTSW 10 23985400 missense probably benign
R4944:Taar6 UTSW 10 23984715 missense probably damaging 1.00
R4951:Taar6 UTSW 10 23985208 missense probably benign 0.09
R5173:Taar6 UTSW 10 23985352 missense probably damaging 1.00
R5181:Taar6 UTSW 10 23984785 missense possibly damaging 0.76
R5919:Taar6 UTSW 10 23985270 missense probably damaging 1.00
R5988:Taar6 UTSW 10 23985256 missense probably damaging 0.98
R6327:Taar6 UTSW 10 23985279 missense probably damaging 1.00
R6493:Taar6 UTSW 10 23985123 missense probably benign 0.36
R7595:Taar6 UTSW 10 23985070 missense probably benign
R8053:Taar6 UTSW 10 23985246 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- GAAAATCTATCAGCACCCAGTTCTG -3'
(R):5'- CATTGCATCCTTGGCCTGTG -3'

Sequencing Primer
(F):5'- GTTCTGATTCACAACTACCTGACAG -3'
(R):5'- ATCCTTGGCCTGTGCTGAC -3'
Posted On2019-11-26