Incidental Mutation 'R7802:Gna15'
ID600576
Institutional Source Beutler Lab
Gene Symbol Gna15
Ensembl Gene ENSMUSG00000034792
Gene Nameguanine nucleotide binding protein, alpha 15
SynonymsGalpha15, G[a]15
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock #R7802 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location81502306-81524225 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 81514341 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 76 (R76G)
Ref Sequence ENSEMBL: ENSMUSP00000049175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043709]
Predicted Effect probably benign
Transcript: ENSMUST00000043709
AA Change: R76G

PolyPhen 2 Score 0.283 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000049175
Gene: ENSMUSG00000034792
AA Change: R76G

DomainStartEndE-ValueType
G_alpha 22 373 1.22e-188 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (35/36)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null mutation exhibit normal hematopoiesis and normal response to inflammatory challenges. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
Abl1 T C 2: 31,760,426 V12A probably benign Het
Bahcc1 T C 11: 120,274,692 F983S probably benign Het
Cecr2 T C 6: 120,743,847 I312T probably benign Het
Col6a2 A T 10: 76,603,798 W711R probably damaging Het
Epb41l4a A G 18: 33,828,174 F436L probably benign Het
Epha1 C T 6: 42,361,941 R641Q possibly damaging Het
Ercc6 C A 14: 32,517,303 A116E probably damaging Het
Ermard A G 17: 15,061,161 E611G probably benign Het
Galnt16 T G 12: 80,581,247 I239S probably damaging Het
Herc2 A G 7: 56,164,090 Y2657C probably damaging Het
Mapkapk2 T C 1: 131,056,902 I238V possibly damaging Het
Med13l T C 5: 118,728,590 S570P probably benign Het
Mettl7a1 A T 15: 100,305,301 N152I possibly damaging Het
Mrap C T 16: 90,749,359 T112M probably benign Het
Nadsyn1 T C 7: 143,806,026 Q403R probably benign Het
Nostrin T C 2: 69,189,012 V467A probably benign Het
Palb2 A T 7: 122,110,896 probably null Het
Parp16 A G 9: 65,229,897 N135S probably benign Het
Pcnt A T 10: 76,375,303 probably null Het
Pde8b T C 13: 95,100,938 D116G probably damaging Het
Psmc5 T C 11: 106,261,712 probably null Het
Rsf1 G T 7: 97,661,772 V570F Het
Rundc3a A G 11: 102,400,009 E306G probably benign Het
Serpinb6b C T 13: 32,971,596 Het
Setx A G 2: 29,147,021 T1173A probably benign Het
Slamf8 A G 1: 172,588,110 S54P probably damaging Het
Slc5a2 A C 7: 128,271,798 D570A possibly damaging Het
Slco5a1 T A 1: 12,990,476 Q7L possibly damaging Het
Stt3b G T 9: 115,276,881 S175R probably damaging Het
Taar6 T A 10: 23,985,253 I132F probably benign Het
Tenm3 A G 8: 48,236,465 V2029A probably damaging Het
Tgm4 A G 9: 123,051,336 probably benign Het
Togaram1 T A 12: 64,966,984 C336* probably null Het
Ttn G A 2: 76,937,671 T3028M unknown Het
Vmn2r25 A T 6: 123,851,832 I161N possibly damaging Het
Vwf T C 6: 125,666,677 C2394R Het
Other mutations in Gna15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02337:Gna15 APN 10 81514410 missense probably damaging 1.00
IGL03346:Gna15 APN 10 81503045 missense probably damaging 0.99
R0062:Gna15 UTSW 10 81512405 splice site probably null
R0062:Gna15 UTSW 10 81512405 splice site probably null
R0464:Gna15 UTSW 10 81512504 missense probably benign 0.15
R0732:Gna15 UTSW 10 81512556 missense probably damaging 0.97
R1529:Gna15 UTSW 10 81509342 missense probably damaging 1.00
R1768:Gna15 UTSW 10 81512120 missense probably damaging 1.00
R2151:Gna15 UTSW 10 81502904 missense probably damaging 1.00
R2153:Gna15 UTSW 10 81502904 missense probably damaging 1.00
R5575:Gna15 UTSW 10 81523873 missense probably damaging 1.00
R5750:Gna15 UTSW 10 81509396 nonsense probably null
R5790:Gna15 UTSW 10 81509384 missense probably damaging 1.00
R6123:Gna15 UTSW 10 81509344 missense probably damaging 1.00
R6222:Gna15 UTSW 10 81512046 missense probably damaging 1.00
R6750:Gna15 UTSW 10 81514283 missense probably benign
R7138:Gna15 UTSW 10 81508047 missense probably damaging 1.00
R7426:Gna15 UTSW 10 81502997 missense probably benign 0.03
R7542:Gna15 UTSW 10 81514302 missense probably damaging 1.00
R7942:Gna15 UTSW 10 81523911 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GAACCTGACTGGCGGATCTTTG -3'
(R):5'- TCTATGGGTACTATGGGCACTG -3'

Sequencing Primer
(F):5'- GGTGTTCTTGGGATCCATGC -3'
(R):5'- ACTATGGGCACTGTGGCTGC -3'
Posted On2019-11-26