Incidental Mutation 'R7802:Psmc5'
ID600578
Institutional Source Beutler Lab
Gene Symbol Psmc5
Ensembl Gene ENSMUSG00000020708
Gene Nameprotease (prosome, macropain) 26S subunit, ATPase 5
SynonymsmSUG1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R7802 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location106256154-106263120 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 106261712 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021049] [ENSMUST00000021052] [ENSMUST00000106843] [ENSMUST00000133131] [ENSMUST00000140255]
Predicted Effect probably null
Transcript: ENSMUST00000021049
SMART Domains Protein: ENSMUSP00000021049
Gene: ENSMUSG00000020708

DomainStartEndE-ValueType
low complexity region 57 69 N/A INTRINSIC
low complexity region 96 108 N/A INTRINSIC
AAA 182 321 6.96e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000021052
SMART Domains Protein: ENSMUSP00000021052
Gene: ENSMUSG00000078619

DomainStartEndE-ValueType
low complexity region 5 42 N/A INTRINSIC
low complexity region 44 58 N/A INTRINSIC
low complexity region 122 131 N/A INTRINSIC
Blast:KISc 136 287 2e-36 BLAST
SWIB 307 386 1.3e-21 SMART
Blast:MYSc 468 514 5e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000106843
SMART Domains Protein: ENSMUSP00000102456
Gene: ENSMUSG00000078619

DomainStartEndE-ValueType
low complexity region 75 84 N/A INTRINSIC
Blast:KISc 89 240 1e-36 BLAST
SWIB 260 339 1.3e-21 SMART
Blast:MYSc 421 467 5e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000133131
SMART Domains Protein: ENSMUSP00000138057
Gene: ENSMUSG00000020708

DomainStartEndE-ValueType
low complexity region 57 69 N/A INTRINSIC
low complexity region 96 108 N/A INTRINSIC
AAA 182 321 6.96e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140255
SMART Domains Protein: ENSMUSP00000133629
Gene: ENSMUSG00000078619

DomainStartEndE-ValueType
SWIB 29 108 1.3e-21 SMART
Blast:MYSc 190 236 6e-12 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the ATPase subunits, a member of the triple-A family of ATPases which have a chaperone-like activity. In addition to participation in proteasome functions, this subunit may participate in transcriptional regulation since it has been shown to interact with the thyroid hormone receptor and retinoid X receptor-alpha. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for a phospho-mimetic allele exhibit absence of cocaine locomotor activity sensitization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
Abl1 T C 2: 31,760,426 V12A probably benign Het
Bahcc1 T C 11: 120,274,692 F983S probably benign Het
Cecr2 T C 6: 120,743,847 I312T probably benign Het
Col6a2 A T 10: 76,603,798 W711R probably damaging Het
Epb41l4a A G 18: 33,828,174 F436L probably benign Het
Epha1 C T 6: 42,361,941 R641Q possibly damaging Het
Ercc6 C A 14: 32,517,303 A116E probably damaging Het
Ermard A G 17: 15,061,161 E611G probably benign Het
Galnt16 T G 12: 80,581,247 I239S probably damaging Het
Gna15 T C 10: 81,514,341 R76G probably benign Het
Herc2 A G 7: 56,164,090 Y2657C probably damaging Het
Mapkapk2 T C 1: 131,056,902 I238V possibly damaging Het
Med13l T C 5: 118,728,590 S570P probably benign Het
Mettl7a1 A T 15: 100,305,301 N152I possibly damaging Het
Mrap C T 16: 90,749,359 T112M probably benign Het
Nadsyn1 T C 7: 143,806,026 Q403R probably benign Het
Nostrin T C 2: 69,189,012 V467A probably benign Het
Palb2 A T 7: 122,110,896 probably null Het
Parp16 A G 9: 65,229,897 N135S probably benign Het
Pcnt A T 10: 76,375,303 probably null Het
Pde8b T C 13: 95,100,938 D116G probably damaging Het
Rsf1 G T 7: 97,661,772 V570F Het
Rundc3a A G 11: 102,400,009 E306G probably benign Het
Serpinb6b C T 13: 32,971,596 Het
Setx A G 2: 29,147,021 T1173A probably benign Het
Slamf8 A G 1: 172,588,110 S54P probably damaging Het
Slc5a2 A C 7: 128,271,798 D570A possibly damaging Het
Slco5a1 T A 1: 12,990,476 Q7L possibly damaging Het
Stt3b G T 9: 115,276,881 S175R probably damaging Het
Taar6 T A 10: 23,985,253 I132F probably benign Het
Tenm3 A G 8: 48,236,465 V2029A probably damaging Het
Tgm4 A G 9: 123,051,336 probably benign Het
Togaram1 T A 12: 64,966,984 C336* probably null Het
Ttn G A 2: 76,937,671 T3028M unknown Het
Vmn2r25 A T 6: 123,851,832 I161N possibly damaging Het
Vwf T C 6: 125,666,677 C2394R Het
Other mutations in Psmc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02234:Psmc5 APN 11 106263010 missense probably benign 0.21
IGL02508:Psmc5 APN 11 106263043 missense possibly damaging 0.54
R0398:Psmc5 UTSW 11 106261544 missense probably benign 0.01
R0529:Psmc5 UTSW 11 106261164 splice site probably null
R1642:Psmc5 UTSW 11 106262416 missense probably benign 0.16
R5353:Psmc5 UTSW 11 106261501 missense probably damaging 0.98
R6159:Psmc5 UTSW 11 106261262 missense possibly damaging 0.82
R7647:Psmc5 UTSW 11 106261607 missense possibly damaging 0.58
X0027:Psmc5 UTSW 11 106262592 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- ATCTTACCTAACAAGGTGGACC -3'
(R):5'- CAATGTCTTCCCAGTGCCTG -3'

Sequencing Primer
(F):5'- ACCCTTTGGTGTCACTAATGATG -3'
(R):5'- CTAGAGGGAGAGTATACATTACACTC -3'
Posted On2019-11-26