Incidental Mutation 'R7802:Serpinb6b'
ID600582
Institutional Source Beutler Lab
Gene Symbol Serpinb6b
Ensembl Gene ENSMUSG00000042842
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 6b
SynonymsNK13, ovalbumin, Spi12
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R7802 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location32965209-32979067 bp(+) (GRCm38)
Type of Mutation
DNA Base Change (assembly) C to T at 32971596 bp
ZygosityHeterozygous
Amino Acid Change
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
Abl1 T C 2: 31,760,426 V12A probably benign Het
Bahcc1 T C 11: 120,274,692 F983S probably benign Het
Cecr2 T C 6: 120,743,847 I312T probably benign Het
Col6a2 A T 10: 76,603,798 W711R probably damaging Het
Epb41l4a A G 18: 33,828,174 F436L probably benign Het
Epha1 C T 6: 42,361,941 R641Q possibly damaging Het
Ercc6 C A 14: 32,517,303 A116E probably damaging Het
Ermard A G 17: 15,061,161 E611G probably benign Het
Galnt16 T G 12: 80,581,247 I239S probably damaging Het
Gna15 T C 10: 81,514,341 R76G probably benign Het
Herc2 A G 7: 56,164,090 Y2657C probably damaging Het
Mapkapk2 T C 1: 131,056,902 I238V possibly damaging Het
Med13l T C 5: 118,728,590 S570P probably benign Het
Mettl7a1 A T 15: 100,305,301 N152I possibly damaging Het
Mrap C T 16: 90,749,359 T112M probably benign Het
Nadsyn1 T C 7: 143,806,026 Q403R probably benign Het
Nostrin T C 2: 69,189,012 V467A probably benign Het
Palb2 A T 7: 122,110,896 probably null Het
Parp16 A G 9: 65,229,897 N135S probably benign Het
Pcnt A T 10: 76,375,303 probably null Het
Pde8b T C 13: 95,100,938 D116G probably damaging Het
Psmc5 T C 11: 106,261,712 probably null Het
Rsf1 G T 7: 97,661,772 V570F Het
Rundc3a A G 11: 102,400,009 E306G probably benign Het
Setx A G 2: 29,147,021 T1173A probably benign Het
Slamf8 A G 1: 172,588,110 S54P probably damaging Het
Slc5a2 A C 7: 128,271,798 D570A possibly damaging Het
Slco5a1 T A 1: 12,990,476 Q7L possibly damaging Het
Stt3b G T 9: 115,276,881 S175R probably damaging Het
Taar6 T A 10: 23,985,253 I132F probably benign Het
Tenm3 A G 8: 48,236,465 V2029A probably damaging Het
Tgm4 A G 9: 123,051,336 probably benign Het
Togaram1 T A 12: 64,966,984 C336* probably null Het
Ttn G A 2: 76,937,671 T3028M unknown Het
Vmn2r25 A T 6: 123,851,832 I161N possibly damaging Het
Vwf T C 6: 125,666,677 C2394R Het
Other mutations in Serpinb6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Serpinb6b APN 13 32971546 missense probably benign 0.01
IGL01077:Serpinb6b APN 13 32978066 missense possibly damaging 0.68
IGL01553:Serpinb6b APN 13 32974948 missense probably damaging 1.00
IGL02981:Serpinb6b APN 13 32971606 missense probably benign 0.34
R0308:Serpinb6b UTSW 13 32978237 missense probably benign 0.09
R1568:Serpinb6b UTSW 13 32974912 missense probably damaging 1.00
R1692:Serpinb6b UTSW 13 32974995 missense probably damaging 1.00
R1763:Serpinb6b UTSW 13 32978058 missense probably damaging 1.00
R1917:Serpinb6b UTSW 13 32978240 missense probably benign
R1918:Serpinb6b UTSW 13 32978240 missense probably benign
R1919:Serpinb6b UTSW 13 32978240 missense probably benign
R1920:Serpinb6b UTSW 13 32975008 missense possibly damaging 0.47
R3032:Serpinb6b UTSW 13 32968568 missense possibly damaging 0.78
R4239:Serpinb6b UTSW 13 32972263 missense probably damaging 0.96
R5089:Serpinb6b UTSW 13 32978150 missense probably benign
R5503:Serpinb6b UTSW 13 32977659 missense possibly damaging 0.95
R5540:Serpinb6b UTSW 13 32977558 nonsense probably null
R6061:Serpinb6b UTSW 13 32977994 missense probably damaging 0.99
R6253:Serpinb6b UTSW 13 32972272 missense probably damaging 1.00
R7156:Serpinb6b UTSW 13 32971615 missense probably benign 0.09
R7248:Serpinb6b UTSW 13 32977576 missense probably benign 0.23
R7315:Serpinb6b UTSW 13 32972257 missense probably benign 0.41
R7424:Serpinb6b UTSW 13 32968667 missense probably damaging 0.99
R7547:Serpinb6b UTSW 13 32974924 missense probably benign 0.05
R7732:Serpinb6b UTSW 13 32968607 missense probably damaging 1.00
R7770:Serpinb6b UTSW 13 32977529 missense probably benign 0.05
Predicted Primers
Posted On2019-11-26