Incidental Mutation 'R7802:Serpinb6b'
ID 600582
Institutional Source Beutler Lab
Gene Symbol Serpinb6b
Ensembl Gene ENSMUSG00000042842
Gene Name serine (or cysteine) peptidase inhibitor, clade B, member 6b
Synonyms NK13, ovalbumin, Spi12
MMRRC Submission 045857-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.071) question?
Stock # R7802 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 33149192-33163050 bp(+) (GRCm39)
Type of Mutation
DNA Base Change (assembly) C to T at 33155579 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
AlphaFold O08804
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 T C 2: 31,650,438 (GRCm39) V12A probably benign Het
Bahcc1 T C 11: 120,165,518 (GRCm39) F983S probably benign Het
Cecr2 T C 6: 120,720,808 (GRCm39) I312T probably benign Het
Col6a2 A T 10: 76,439,632 (GRCm39) W711R probably damaging Het
Epb41l4a A G 18: 33,961,227 (GRCm39) F436L probably benign Het
Epha1 C T 6: 42,338,875 (GRCm39) R641Q possibly damaging Het
Ercc6 C A 14: 32,239,260 (GRCm39) A116E probably damaging Het
Ermard A G 17: 15,281,423 (GRCm39) E611G probably benign Het
Galnt16 T G 12: 80,628,021 (GRCm39) I239S probably damaging Het
Gna15 T C 10: 81,350,175 (GRCm39) R76G probably benign Het
Herc2 A G 7: 55,813,838 (GRCm39) Y2657C probably damaging Het
Mapkapk2 T C 1: 130,984,639 (GRCm39) I238V possibly damaging Het
Med13l T C 5: 118,866,655 (GRCm39) S570P probably benign Het
Mrap C T 16: 90,546,247 (GRCm39) T112M probably benign Het
Nadsyn1 T C 7: 143,359,763 (GRCm39) Q403R probably benign Het
Nostrin T C 2: 69,019,356 (GRCm39) V467A probably benign Het
Palb2 A T 7: 121,710,119 (GRCm39) probably null Het
Parp16 A G 9: 65,137,179 (GRCm39) N135S probably benign Het
Pcnt A T 10: 76,211,137 (GRCm39) probably null Het
Pde8b T C 13: 95,237,446 (GRCm39) D116G probably damaging Het
Pierce1 TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,356,122 (GRCm39) probably benign Het
Psmc5 T C 11: 106,152,538 (GRCm39) probably null Het
Rsf1 G T 7: 97,310,979 (GRCm39) V570F Het
Rundc3a A G 11: 102,290,835 (GRCm39) E306G probably benign Het
Setx A G 2: 29,037,033 (GRCm39) T1173A probably benign Het
Slamf8 A G 1: 172,415,677 (GRCm39) S54P probably damaging Het
Slc5a2 A C 7: 127,870,970 (GRCm39) D570A possibly damaging Het
Slco5a1 T A 1: 13,060,700 (GRCm39) Q7L possibly damaging Het
Stt3b G T 9: 115,105,949 (GRCm39) S175R probably damaging Het
Taar6 T A 10: 23,861,151 (GRCm39) I132F probably benign Het
Tenm3 A G 8: 48,689,500 (GRCm39) V2029A probably damaging Het
Tgm4 A G 9: 122,880,401 (GRCm39) probably benign Het
Tmt1a A T 15: 100,203,182 (GRCm39) N152I possibly damaging Het
Togaram1 T A 12: 65,013,758 (GRCm39) C336* probably null Het
Ttn G A 2: 76,768,015 (GRCm39) T3028M unknown Het
Vmn2r25 A T 6: 123,828,791 (GRCm39) I161N possibly damaging Het
Vwf T C 6: 125,643,640 (GRCm39) C2394R Het
Other mutations in Serpinb6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Serpinb6b APN 13 33,155,529 (GRCm39) missense probably benign 0.01
IGL01077:Serpinb6b APN 13 33,162,049 (GRCm39) missense possibly damaging 0.68
IGL01553:Serpinb6b APN 13 33,158,931 (GRCm39) missense probably damaging 1.00
IGL02981:Serpinb6b APN 13 33,155,589 (GRCm39) missense probably benign 0.34
R0308:Serpinb6b UTSW 13 33,162,220 (GRCm39) missense probably benign 0.09
R1568:Serpinb6b UTSW 13 33,158,895 (GRCm39) missense probably damaging 1.00
R1692:Serpinb6b UTSW 13 33,158,978 (GRCm39) missense probably damaging 1.00
R1763:Serpinb6b UTSW 13 33,162,041 (GRCm39) missense probably damaging 1.00
R1917:Serpinb6b UTSW 13 33,162,223 (GRCm39) missense probably benign
R1918:Serpinb6b UTSW 13 33,162,223 (GRCm39) missense probably benign
R1919:Serpinb6b UTSW 13 33,162,223 (GRCm39) missense probably benign
R1920:Serpinb6b UTSW 13 33,158,991 (GRCm39) missense possibly damaging 0.47
R3032:Serpinb6b UTSW 13 33,152,551 (GRCm39) missense possibly damaging 0.78
R4239:Serpinb6b UTSW 13 33,156,246 (GRCm39) missense probably damaging 0.96
R5089:Serpinb6b UTSW 13 33,162,133 (GRCm39) missense probably benign
R5503:Serpinb6b UTSW 13 33,161,642 (GRCm39) missense possibly damaging 0.95
R5540:Serpinb6b UTSW 13 33,161,541 (GRCm39) nonsense probably null
R6061:Serpinb6b UTSW 13 33,161,977 (GRCm39) missense probably damaging 0.99
R6253:Serpinb6b UTSW 13 33,156,255 (GRCm39) missense probably damaging 1.00
R7156:Serpinb6b UTSW 13 33,155,598 (GRCm39) missense probably benign 0.09
R7248:Serpinb6b UTSW 13 33,161,559 (GRCm39) missense probably benign 0.23
R7315:Serpinb6b UTSW 13 33,156,240 (GRCm39) missense probably benign 0.41
R7424:Serpinb6b UTSW 13 33,152,650 (GRCm39) missense probably damaging 0.99
R7547:Serpinb6b UTSW 13 33,158,907 (GRCm39) missense probably benign 0.05
R7732:Serpinb6b UTSW 13 33,152,590 (GRCm39) missense probably damaging 1.00
R7770:Serpinb6b UTSW 13 33,161,512 (GRCm39) missense probably benign 0.05
R8814:Serpinb6b UTSW 13 33,162,287 (GRCm39) missense possibly damaging 0.94
R8966:Serpinb6b UTSW 13 33,162,035 (GRCm39) missense probably damaging 1.00
R8988:Serpinb6b UTSW 13 33,162,125 (GRCm39) missense probably benign 0.45
R9037:Serpinb6b UTSW 13 33,161,998 (GRCm39) nonsense probably null
R9129:Serpinb6b UTSW 13 33,162,139 (GRCm39) small deletion probably benign
R9377:Serpinb6b UTSW 13 33,152,494 (GRCm39) start codon destroyed probably null 1.00
R9415:Serpinb6b UTSW 13 33,159,002 (GRCm39) missense
R9632:Serpinb6b UTSW 13 33,155,532 (GRCm39) missense possibly damaging 0.91
Predicted Primers
Posted On 2019-11-26