Incidental Mutation 'R7802:Mettl7a1'
ID600585
Institutional Source Beutler Lab
Gene Symbol Mettl7a1
Ensembl Gene ENSMUSG00000054619
Gene Namemethyltransferase like 7A1
SynonymsMettl7a, 3300001H21Rik, 2210414H16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.217) question?
Stock #R7802 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location100304140-100328662 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100305301 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 152 (N152I)
Ref Sequence ENSEMBL: ENSMUSP00000065271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067752] [ENSMUST00000229217] [ENSMUST00000229574] [ENSMUST00000229588] [ENSMUST00000230018] [ENSMUST00000230252] [ENSMUST00000230472] [ENSMUST00000231166]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067752
AA Change: N152I

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000065271
Gene: ENSMUSG00000054619
AA Change: N152I

DomainStartEndE-ValueType
Pfam:Ubie_methyltran 31 195 7.7e-12 PFAM
Pfam:Methyltransf_23 47 221 7e-20 PFAM
Pfam:Methyltransf_31 68 223 1.5e-15 PFAM
Pfam:Methyltransf_18 71 176 1e-9 PFAM
Pfam:Methyltransf_25 74 168 4e-12 PFAM
Pfam:Methyltransf_12 75 170 8.6e-16 PFAM
Pfam:Methyltransf_11 75 172 6.6e-23 PFAM
Pfam:Methyltransf_8 117 197 1.1e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000229217
AA Change: N101I

PolyPhen 2 Score 0.736 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect unknown
Transcript: ENSMUST00000229574
AA Change: E76D
Predicted Effect probably damaging
Transcript: ENSMUST00000229588
AA Change: N152I

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000230018
AA Change: N44I

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000230252
AA Change: N74I

PolyPhen 2 Score 0.736 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000230472
AA Change: N134I

PolyPhen 2 Score 0.558 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect unknown
Transcript: ENSMUST00000231166
AA Change: E109D
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
Abl1 T C 2: 31,760,426 V12A probably benign Het
Bahcc1 T C 11: 120,274,692 F983S probably benign Het
Cecr2 T C 6: 120,743,847 I312T probably benign Het
Col6a2 A T 10: 76,603,798 W711R probably damaging Het
Epb41l4a A G 18: 33,828,174 F436L probably benign Het
Epha1 C T 6: 42,361,941 R641Q possibly damaging Het
Ercc6 C A 14: 32,517,303 A116E probably damaging Het
Ermard A G 17: 15,061,161 E611G probably benign Het
Galnt16 T G 12: 80,581,247 I239S probably damaging Het
Gna15 T C 10: 81,514,341 R76G probably benign Het
Herc2 A G 7: 56,164,090 Y2657C probably damaging Het
Mapkapk2 T C 1: 131,056,902 I238V possibly damaging Het
Med13l T C 5: 118,728,590 S570P probably benign Het
Mrap C T 16: 90,749,359 T112M probably benign Het
Nadsyn1 T C 7: 143,806,026 Q403R probably benign Het
Nostrin T C 2: 69,189,012 V467A probably benign Het
Palb2 A T 7: 122,110,896 probably null Het
Parp16 A G 9: 65,229,897 N135S probably benign Het
Pcnt A T 10: 76,375,303 probably null Het
Pde8b T C 13: 95,100,938 D116G probably damaging Het
Psmc5 T C 11: 106,261,712 probably null Het
Rsf1 G T 7: 97,661,772 V570F Het
Rundc3a A G 11: 102,400,009 E306G probably benign Het
Serpinb6b C T 13: 32,971,596 Het
Setx A G 2: 29,147,021 T1173A probably benign Het
Slamf8 A G 1: 172,588,110 S54P probably damaging Het
Slc5a2 A C 7: 128,271,798 D570A possibly damaging Het
Slco5a1 T A 1: 12,990,476 Q7L possibly damaging Het
Stt3b G T 9: 115,276,881 S175R probably damaging Het
Taar6 T A 10: 23,985,253 I132F probably benign Het
Tenm3 A G 8: 48,236,465 V2029A probably damaging Het
Tgm4 A G 9: 123,051,336 probably benign Het
Togaram1 T A 12: 64,966,984 C336* probably null Het
Ttn G A 2: 76,937,671 T3028M unknown Het
Vmn2r25 A T 6: 123,851,832 I161N possibly damaging Het
Vwf T C 6: 125,666,677 C2394R Het
Other mutations in Mettl7a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02820:Mettl7a1 APN 15 100305052 nonsense probably null
R0943:Mettl7a1 UTSW 15 100304958 missense probably benign 0.19
R2258:Mettl7a1 UTSW 15 100313168 missense probably benign 0.43
R2259:Mettl7a1 UTSW 15 100313168 missense probably benign 0.43
R4260:Mettl7a1 UTSW 15 100313070 missense probably benign 0.12
R4625:Mettl7a1 UTSW 15 100313058 missense probably damaging 1.00
R4932:Mettl7a1 UTSW 15 100305106 missense probably benign 0.26
R7839:Mettl7a1 UTSW 15 100305076 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- CAGGGTCACTTGTATCGACC -3'
(R):5'- AGATTCTGATTTGTCAGCCCTTAC -3'

Sequencing Primer
(F):5'- GGTCACTTGTATCGACCCCAAC -3'
(R):5'- GCAAAATTCTTCTGGAGTCATTTGG -3'
Posted On2019-11-26