Incidental Mutation 'R7803:Arg1'
ID600620
Institutional Source Beutler Lab
Gene Symbol Arg1
Ensembl Gene ENSMUSG00000019987
Gene Namearginase, liver
SynonymsPGIF, AI, Arg-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.244) question?
Stock #R7803 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location24915221-24927484 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 24916791 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 182 (V182I)
Ref Sequence ENSEMBL: ENSMUSP00000020161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020159] [ENSMUST00000020161] [ENSMUST00000092646] [ENSMUST00000176285]
Predicted Effect probably benign
Transcript: ENSMUST00000020159
SMART Domains Protein: ENSMUSP00000020159
Gene: ENSMUSG00000019984

DomainStartEndE-ValueType
Pfam:Med23 3 1310 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000020161
AA Change: V182I

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000020161
Gene: ENSMUSG00000019987
AA Change: V182I

DomainStartEndE-ValueType
Pfam:Arginase 6 305 1.4e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092646
SMART Domains Protein: ENSMUSP00000090316
Gene: ENSMUSG00000019984

DomainStartEndE-ValueType
Pfam:Med23 4 1316 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176285
SMART Domains Protein: ENSMUSP00000135232
Gene: ENSMUSG00000019984

DomainStartEndE-ValueType
Pfam:Med23 1 51 4.4e-14 PFAM
Pfam:Med23 48 950 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Arginase catalyzes the hydrolysis of arginine to ornithine and urea. At least two isoforms of mammalian arginase exist (types I and II) which differ in their tissue distribution, subcellular localization, immunologic crossreactivity and physiologic function. The type I isoform encoded by this gene, is a cytosolic enzyme and expressed predominantly in the liver as a component of the urea cycle. Inherited deficiency of this enzyme results in argininemia, an autosomal recessive disorder characterized by hyperammonemia. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a null allele show postnatal lethality, hyperammonemia, argininemia, altered plasma levels of other amino acids, enlarged pale livers, and abnormal hepatocytes. Mice homozygous for a different null allele show postnatal lethality, andincreased macrophage nitric oxide production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 C A 19: 34,243,418 A297S probably benign Het
Ada A G 2: 163,735,368 Y67H probably benign Het
Adcy9 A G 16: 4,304,380 I839T probably benign Het
Cbx7 G A 15: 79,933,823 T26M unknown Het
Ceacam5 A G 7: 17,759,392 Y780C probably damaging Het
Ces2h A G 8: 105,018,400 M389V probably benign Het
Chst11 A T 10: 83,191,186 E149V possibly damaging Het
Clstn1 T C 4: 149,631,871 W265R probably damaging Het
Col4a4 A G 1: 82,489,698 probably null Het
Csrp3 T G 7: 48,833,797 K119T probably benign Het
Ddx39 T C 8: 83,719,600 probably null Het
Ddx41 A G 13: 55,531,921 I437T probably damaging Het
Fbln5 A T 12: 101,761,818 D282E probably damaging Het
Folh1 G A 7: 86,726,098 T527I probably damaging Het
Gch1 T A 14: 47,188,961 T103S probably benign Het
Gm2022 T A 12: 87,895,499 C44S probably benign Het
Gm906 A G 13: 50,246,190 V700A probably benign Het
Gpr149 A G 3: 62,530,715 S674P probably damaging Het
Hecw1 G T 13: 14,234,342 R1127S probably benign Het
Hmcn1 A T 1: 150,770,279 C723S probably benign Het
Impg2 T C 16: 56,267,150 S1111P probably damaging Het
Insl3 T C 8: 71,689,340 L28P probably damaging Het
Kifc1 T C 17: 33,884,740 D203G probably benign Het
Kmt2d A T 15: 98,862,923 S849T unknown Het
Krt33b A G 11: 100,025,258 probably null Het
Lpin3 A G 2: 160,895,390 D119G possibly damaging Het
Maml2 AGC AGCCGC 9: 13,621,254 probably benign Het
Maml2 AGC AGCCGC 9: 13,621,275 probably benign Het
Maml2 GCA GCACCA 9: 13,621,276 probably benign Het
Nsun7 T A 5: 66,276,541 L178* probably null Het
Olfr775 A T 10: 129,250,995 I154F probably benign Het
Olfr786 A G 10: 129,436,931 N40D probably damaging Het
Olfr972 A T 9: 39,874,082 D269V probably benign Het
Orc6 T A 8: 85,303,408 S136T possibly damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Plxnc1 A G 10: 94,943,515 probably null Het
Prkdc G A 16: 15,806,096 D3308N probably null Het
Rtkn2 G A 10: 67,979,813 probably null Het
Sele T C 1: 164,050,694 S201P possibly damaging Het
Shq1 A G 6: 100,671,045 F6S probably damaging Het
Sparc A T 11: 55,409,971 I5N probably damaging Het
Srm T C 4: 148,593,945 I238T probably damaging Het
Stx2 C A 5: 128,993,563 E97* probably null Het
Sugp2 C T 8: 70,252,072 P753L probably benign Het
Tenm2 A T 11: 36,047,116 S1578T probably damaging Het
Tff3 T C 17: 31,129,570 T3A probably benign Het
Tmem38a C T 8: 72,572,120 A6V probably benign Het
Trbv16 G A 6: 41,151,995 A38T not run Het
Trim30a G A 7: 104,411,397 Q391* probably null Het
Ttn T G 2: 76,776,371 Y18065S probably damaging Het
Ubr5 G A 15: 37,979,832 A2434V probably null Het
Vmn2r24 T A 6: 123,780,479 M102K probably benign Het
Vmn2r69 G T 7: 85,407,116 H605N probably benign Het
Washc1 T A 17: 66,119,060 M451K possibly damaging Het
Washc3 G T 10: 88,216,075 probably null Het
Washc5 A T 15: 59,368,459 Y112N probably damaging Het
Zbtb40 T A 4: 137,017,327 T261S probably benign Het
Other mutations in Arg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02011:Arg1 APN 10 24916377 missense probably benign 0.00
IGL02889:Arg1 APN 10 24915755 missense probably damaging 0.98
R0180:Arg1 UTSW 10 24916830 missense probably benign
R0256:Arg1 UTSW 10 24916458 missense probably benign 0.00
R0588:Arg1 UTSW 10 24920624 missense probably damaging 1.00
R1014:Arg1 UTSW 10 24916860 missense probably benign
R1327:Arg1 UTSW 10 24920804 splice site probably null
R1965:Arg1 UTSW 10 24916864 splice site probably null
R2071:Arg1 UTSW 10 24922663 missense probably benign 0.00
R2118:Arg1 UTSW 10 24920723 missense possibly damaging 0.58
R4158:Arg1 UTSW 10 24922677 missense probably damaging 1.00
R4858:Arg1 UTSW 10 24922638 missense possibly damaging 0.73
R5741:Arg1 UTSW 10 24917999 missense probably benign
R5793:Arg1 UTSW 10 24920642 missense probably benign 0.36
R7453:Arg1 UTSW 10 24915776 missense probably damaging 1.00
R7634:Arg1 UTSW 10 24915729 missense possibly damaging 0.46
R7760:Arg1 UTSW 10 24927463 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TCACTGTAAGTCCTGTGAACTG -3'
(R):5'- GAAACTTCTCTCCAAATTCTGGC -3'

Sequencing Primer
(F):5'- CCTGTGAACTGTGTATATATGCAGC -3'
(R):5'- CTGGCTTAAGTCTTTTTGAGAAGCAC -3'
Posted On2019-11-26