Incidental Mutation 'R7803:Hecw1'
ID600632
Institutional Source Beutler Lab
Gene Symbol Hecw1
Ensembl Gene ENSMUSG00000021301
Gene NameHECT, C2 and WW domain containing E3 ubiquitin protein ligase 1
SynonymsE130207I19Rik, NEDL1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7803 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location14226438-14523228 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 14234342 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 1127 (R1127S)
Ref Sequence ENSEMBL: ENSMUSP00000152215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110516] [ENSMUST00000220718]
Predicted Effect possibly damaging
Transcript: ENSMUST00000110516
AA Change: R1554S

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000106145
Gene: ENSMUSG00000021301
AA Change: R1554S

DomainStartEndE-ValueType
Pfam:HECW_N 65 184 6.5e-62 PFAM
C2 206 317 1.02e-12 SMART
low complexity region 463 477 N/A INTRINSIC
low complexity region 497 512 N/A INTRINSIC
low complexity region 577 598 N/A INTRINSIC
low complexity region 677 704 N/A INTRINSIC
low complexity region 731 745 N/A INTRINSIC
WW 827 859 8.66e-13 SMART
coiled coil region 873 898 N/A INTRINSIC
low complexity region 917 930 N/A INTRINSIC
WW 1017 1049 5.59e-7 SMART
Blast:HECTc 1137 1192 3e-26 BLAST
low complexity region 1193 1208 N/A INTRINSIC
low complexity region 1212 1223 N/A INTRINSIC
HECTc 1267 1604 1.36e-185 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220718
AA Change: R1127S

PolyPhen 2 Score 0.254 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 C A 19: 34,243,418 A297S probably benign Het
Ada A G 2: 163,735,368 Y67H probably benign Het
Adcy9 A G 16: 4,304,380 I839T probably benign Het
Arg1 C T 10: 24,916,791 V182I possibly damaging Het
Cbx7 G A 15: 79,933,823 T26M unknown Het
Ceacam5 A G 7: 17,759,392 Y780C probably damaging Het
Ces2h A G 8: 105,018,400 M389V probably benign Het
Chst11 A T 10: 83,191,186 E149V possibly damaging Het
Clstn1 T C 4: 149,631,871 W265R probably damaging Het
Col4a4 A G 1: 82,489,698 probably null Het
Csrp3 T G 7: 48,833,797 K119T probably benign Het
Ddx39 T C 8: 83,719,600 probably null Het
Ddx41 A G 13: 55,531,921 I437T probably damaging Het
Fbln5 A T 12: 101,761,818 D282E probably damaging Het
Folh1 G A 7: 86,726,098 T527I probably damaging Het
Gch1 T A 14: 47,188,961 T103S probably benign Het
Gm2022 T A 12: 87,895,499 C44S probably benign Het
Gm906 A G 13: 50,246,190 V700A probably benign Het
Gpr149 A G 3: 62,530,715 S674P probably damaging Het
Hmcn1 A T 1: 150,770,279 C723S probably benign Het
Impg2 T C 16: 56,267,150 S1111P probably damaging Het
Insl3 T C 8: 71,689,340 L28P probably damaging Het
Kifc1 T C 17: 33,884,740 D203G probably benign Het
Kmt2d A T 15: 98,862,923 S849T unknown Het
Krt33b A G 11: 100,025,258 probably null Het
Lpin3 A G 2: 160,895,390 D119G possibly damaging Het
Maml2 AGC AGCCGC 9: 13,621,254 probably benign Het
Maml2 AGC AGCCGC 9: 13,621,275 probably benign Het
Maml2 GCA GCACCA 9: 13,621,276 probably benign Het
Nsun7 T A 5: 66,276,541 L178* probably null Het
Olfr775 A T 10: 129,250,995 I154F probably benign Het
Olfr786 A G 10: 129,436,931 N40D probably damaging Het
Olfr972 A T 9: 39,874,082 D269V probably benign Het
Orc6 T A 8: 85,303,408 S136T possibly damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Plxnc1 A G 10: 94,943,515 probably null Het
Prkdc G A 16: 15,806,096 D3308N probably null Het
Rtkn2 G A 10: 67,979,813 probably null Het
Sele T C 1: 164,050,694 S201P possibly damaging Het
Shq1 A G 6: 100,671,045 F6S probably damaging Het
Sparc A T 11: 55,409,971 I5N probably damaging Het
Srm T C 4: 148,593,945 I238T probably damaging Het
Stx2 C A 5: 128,993,563 E97* probably null Het
Sugp2 C T 8: 70,252,072 P753L probably benign Het
Tenm2 A T 11: 36,047,116 S1578T probably damaging Het
Tff3 T C 17: 31,129,570 T3A probably benign Het
Tmem38a C T 8: 72,572,120 A6V probably benign Het
Trbv16 G A 6: 41,151,995 A38T not run Het
Trim30a G A 7: 104,411,397 Q391* probably null Het
Ttn T G 2: 76,776,371 Y18065S probably damaging Het
Ubr5 G A 15: 37,979,832 A2434V probably null Het
Vmn2r24 T A 6: 123,780,479 M102K probably benign Het
Vmn2r69 G T 7: 85,407,116 H605N probably benign Het
Washc1 T A 17: 66,119,060 M451K possibly damaging Het
Washc3 G T 10: 88,216,075 probably null Het
Washc5 A T 15: 59,368,459 Y112N probably damaging Het
Zbtb40 T A 4: 137,017,327 T261S probably benign Het
Other mutations in Hecw1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00591:Hecw1 APN 13 14265980 missense possibly damaging 0.71
IGL00813:Hecw1 APN 13 14278376 critical splice acceptor site probably null
IGL00843:Hecw1 APN 13 14247573 missense probably benign 0.02
IGL00942:Hecw1 APN 13 14340740 splice site probably benign
IGL00976:Hecw1 APN 13 14318972 missense probably damaging 1.00
IGL01289:Hecw1 APN 13 14264134 missense probably damaging 1.00
IGL01675:Hecw1 APN 13 14234422 missense probably damaging 1.00
IGL01783:Hecw1 APN 13 14278293 missense probably damaging 1.00
IGL01941:Hecw1 APN 13 14316310 missense probably benign 0.01
IGL02170:Hecw1 APN 13 14264158 missense possibly damaging 0.75
IGL02172:Hecw1 APN 13 14264149 missense probably damaging 1.00
IGL02214:Hecw1 APN 13 14300393 missense probably damaging 1.00
IGL02350:Hecw1 APN 13 14248338 splice site probably null
IGL02357:Hecw1 APN 13 14248338 splice site probably null
IGL02372:Hecw1 APN 13 14264121 missense probably damaging 1.00
IGL02591:Hecw1 APN 13 14357236 splice site probably benign
IGL02718:Hecw1 APN 13 14306935 critical splice acceptor site probably null
IGL02795:Hecw1 APN 13 14322517 missense probably damaging 1.00
IGL02941:Hecw1 APN 13 14377726 missense probably damaging 1.00
IGL03256:Hecw1 APN 13 14280484 missense probably damaging 0.99
IGL03256:Hecw1 APN 13 14280485 missense probably benign 0.36
IGL03366:Hecw1 APN 13 14377797 missense probably damaging 1.00
deflated UTSW 13 14247620 missense possibly damaging 0.69
Demoralized UTSW 13 14316818 nonsense probably null
Letdown UTSW 13 14316492 missense probably benign 0.40
BB001:Hecw1 UTSW 13 14322528 missense not run
BB011:Hecw1 UTSW 13 14322528 missense not run
IGL03014:Hecw1 UTSW 13 14245808 missense probably damaging 1.00
PIT4378001:Hecw1 UTSW 13 14377783 missense probably damaging 0.98
R0555:Hecw1 UTSW 13 14236941 missense probably damaging 1.00
R0617:Hecw1 UTSW 13 14280442 missense probably benign 0.44
R1476:Hecw1 UTSW 13 14306086 missense probably damaging 1.00
R1479:Hecw1 UTSW 13 14316492 missense probably benign 0.40
R1551:Hecw1 UTSW 13 14316943 missense probably damaging 1.00
R1579:Hecw1 UTSW 13 14377907 missense probably damaging 1.00
R1584:Hecw1 UTSW 13 14340743 critical splice donor site probably null
R1735:Hecw1 UTSW 13 14377765 missense probably null 0.09
R1872:Hecw1 UTSW 13 14280449 nonsense probably null
R1897:Hecw1 UTSW 13 14377940 missense probably damaging 1.00
R2054:Hecw1 UTSW 13 14297413 missense probably damaging 0.97
R2085:Hecw1 UTSW 13 14264087 missense possibly damaging 0.93
R2134:Hecw1 UTSW 13 14377700 missense probably damaging 1.00
R2172:Hecw1 UTSW 13 14377706 missense probably damaging 1.00
R2258:Hecw1 UTSW 13 14316138 missense probably benign 0.01
R2274:Hecw1 UTSW 13 14346068 missense probably benign 0.00
R2275:Hecw1 UTSW 13 14346068 missense probably benign 0.00
R2937:Hecw1 UTSW 13 14245836 missense possibly damaging 0.93
R3830:Hecw1 UTSW 13 14346058 missense probably benign 0.13
R3971:Hecw1 UTSW 13 14236929 missense probably damaging 1.00
R4065:Hecw1 UTSW 13 14316431 missense probably damaging 1.00
R4066:Hecw1 UTSW 13 14316431 missense probably damaging 1.00
R4235:Hecw1 UTSW 13 14317139 missense probably benign 0.42
R4366:Hecw1 UTSW 13 14316164 missense probably damaging 1.00
R4382:Hecw1 UTSW 13 14316164 missense probably damaging 1.00
R4385:Hecw1 UTSW 13 14316164 missense probably damaging 1.00
R4510:Hecw1 UTSW 13 14357191 missense probably damaging 1.00
R4511:Hecw1 UTSW 13 14357191 missense probably damaging 1.00
R4558:Hecw1 UTSW 13 14247605 missense probably damaging 0.99
R4804:Hecw1 UTSW 13 14305985 missense probably benign 0.00
R4854:Hecw1 UTSW 13 14316892 missense probably benign 0.00
R5104:Hecw1 UTSW 13 14340792 missense probably damaging 1.00
R5113:Hecw1 UTSW 13 14346029 missense possibly damaging 0.94
R5167:Hecw1 UTSW 13 14285657 missense probably damaging 1.00
R5392:Hecw1 UTSW 13 14245762 missense probably damaging 1.00
R5394:Hecw1 UTSW 13 14322589 missense probably damaging 1.00
R5504:Hecw1 UTSW 13 14340902 missense probably benign 0.04
R5764:Hecw1 UTSW 13 14322509 missense probably damaging 1.00
R6038:Hecw1 UTSW 13 14346062 missense probably benign 0.28
R6038:Hecw1 UTSW 13 14346062 missense probably benign 0.28
R6228:Hecw1 UTSW 13 14346038 missense probably damaging 1.00
R6247:Hecw1 UTSW 13 14234425 nonsense probably null
R6252:Hecw1 UTSW 13 14272079 missense probably damaging 0.98
R6291:Hecw1 UTSW 13 14523007 unclassified probably benign
R6321:Hecw1 UTSW 13 14522829 missense probably benign 0.00
R6325:Hecw1 UTSW 13 14316446 missense probably damaging 1.00
R6328:Hecw1 UTSW 13 14247620 missense possibly damaging 0.69
R6557:Hecw1 UTSW 13 14316646 missense possibly damaging 0.78
R6566:Hecw1 UTSW 13 14297283 missense probably damaging 1.00
R6597:Hecw1 UTSW 13 14316818 nonsense probably null
R6821:Hecw1 UTSW 13 14264134 missense probably damaging 1.00
R6914:Hecw1 UTSW 13 14316838 missense probably damaging 0.99
R7078:Hecw1 UTSW 13 14434459 start codon destroyed probably null 0.21
R7114:Hecw1 UTSW 13 14311771 missense probably benign 0.02
R7140:Hecw1 UTSW 13 14316533 missense probably benign
R7150:Hecw1 UTSW 13 14434460 start codon destroyed probably benign
R7288:Hecw1 UTSW 13 14316236 missense probably benign 0.00
R7447:Hecw1 UTSW 13 14357204 missense probably damaging 1.00
R7479:Hecw1 UTSW 13 14340840 missense probably damaging 1.00
R7552:Hecw1 UTSW 13 14316250 missense probably damaging 0.99
R7590:Hecw1 UTSW 13 14264083 missense probably damaging 1.00
R7787:Hecw1 UTSW 13 14318909 missense probably damaging 1.00
R8195:Hecw1 UTSW 13 14306107 missense probably damaging 0.99
R8252:Hecw1 UTSW 13 14340840 missense probably damaging 1.00
RF001:Hecw1 UTSW 13 14297424 missense probably damaging 1.00
X0020:Hecw1 UTSW 13 14230723 missense possibly damaging 0.52
X0066:Hecw1 UTSW 13 14280460 missense probably benign 0.13
Z1176:Hecw1 UTSW 13 14300333 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- ACATCTTTAGTAGCACAAACAGCAG -3'
(R):5'- TGCCTATCTAAATGCCATTATCAGC -3'

Sequencing Primer
(F):5'- ACAGCAGTACACTGTGTGAC -3'
(R):5'- GTTCCAGTTCAGTTAACATATCTGTC -3'
Posted On2019-11-26