Incidental Mutation 'R7803:Ubr5'
ID600636
Institutional Source Beutler Lab
Gene Symbol Ubr5
Ensembl Gene ENSMUSG00000037487
Gene Nameubiquitin protein ligase E3 component n-recognin 5
SynonymsEdd, 4432411E13Rik, Edd1
Accession Numbers

NCBI RefSeq: NM_001081359.2, NM_001112721.1; MGI:1918040

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7803 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location37967328-38078854 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 37979832 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 2434 (A2434V)
Ref Sequence ENSEMBL: ENSMUSP00000105965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110336] [ENSMUST00000226414] [ENSMUST00000228333]
Predicted Effect probably null
Transcript: ENSMUST00000110336
AA Change: A2434V
SMART Domains Protein: ENSMUSP00000105965
Gene: ENSMUSG00000037487
AA Change: A2434V

DomainStartEndE-ValueType
low complexity region 94 111 N/A INTRINSIC
low complexity region 129 156 N/A INTRINSIC
Pfam:E3_UbLigase_EDD 179 230 9.7e-35 PFAM
low complexity region 282 323 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
low complexity region 860 870 N/A INTRINSIC
low complexity region 933 950 N/A INTRINSIC
low complexity region 970 999 N/A INTRINSIC
low complexity region 1140 1151 N/A INTRINSIC
ZnF_UBR1 1177 1244 5.42e-27 SMART
low complexity region 1396 1405 N/A INTRINSIC
low complexity region 1524 1537 N/A INTRINSIC
low complexity region 1567 1613 N/A INTRINSIC
low complexity region 1641 1657 N/A INTRINSIC
low complexity region 1662 1687 N/A INTRINSIC
low complexity region 1726 1742 N/A INTRINSIC
low complexity region 1759 1789 N/A INTRINSIC
low complexity region 1879 1890 N/A INTRINSIC
low complexity region 1972 1983 N/A INTRINSIC
low complexity region 1986 1997 N/A INTRINSIC
Blast:HECTc 2271 2313 2e-6 BLAST
low complexity region 2329 2366 N/A INTRINSIC
PolyA 2389 2452 3.97e-33 SMART
HECTc 2432 2798 1e-151 SMART
Predicted Effect probably null
Transcript: ENSMUST00000226414
AA Change: A2440V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000228333
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (49/50)
MGI Phenotype Strain: 3052764
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a progestin-induced protein, which belongs to the HECT (homology to E6-AP carboxyl terminus) family. The HECT family proteins function as E3 ubiquitin-protein ligases, targeting specific proteins for ubiquitin-mediated proteolysis. This gene is localized to chromosome 8q22 which is disrupted in a variety of cancers. This gene potentially has a role in regulation of cell proliferation or differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis, impaired growth of the allantois, failure or impairment of chorioallantoic fusion, impaired angiogenesis in the yolk sac and allantois, decreased cell proliferation, and increased apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(151) : Targeted(3) Gene trapped(148)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 C A 19: 34,243,418 A297S probably benign Het
Ada A G 2: 163,735,368 Y67H probably benign Het
Adcy9 A G 16: 4,304,380 I839T probably benign Het
Arg1 C T 10: 24,916,791 V182I possibly damaging Het
Cbx7 G A 15: 79,933,823 T26M unknown Het
Ceacam5 A G 7: 17,759,392 Y780C probably damaging Het
Ces2h A G 8: 105,018,400 M389V probably benign Het
Chst11 A T 10: 83,191,186 E149V possibly damaging Het
Clstn1 T C 4: 149,631,871 W265R probably damaging Het
Col4a4 A G 1: 82,489,698 probably null Het
Csrp3 T G 7: 48,833,797 K119T probably benign Het
Ddx39 T C 8: 83,719,600 probably null Het
Ddx41 A G 13: 55,531,921 I437T probably damaging Het
Fbln5 A T 12: 101,761,818 D282E probably damaging Het
Folh1 G A 7: 86,726,098 T527I probably damaging Het
Gch1 T A 14: 47,188,961 T103S probably benign Het
Gm2022 T A 12: 87,895,499 C44S probably benign Het
Gm906 A G 13: 50,246,190 V700A probably benign Het
Gpr149 A G 3: 62,530,715 S674P probably damaging Het
Hecw1 G T 13: 14,234,342 R1127S probably benign Het
Hmcn1 A T 1: 150,770,279 C723S probably benign Het
Impg2 T C 16: 56,267,150 S1111P probably damaging Het
Insl3 T C 8: 71,689,340 L28P probably damaging Het
Kifc1 T C 17: 33,884,740 D203G probably benign Het
Kmt2d A T 15: 98,862,923 S849T unknown Het
Krt33b A G 11: 100,025,258 probably null Het
Lpin3 A G 2: 160,895,390 D119G possibly damaging Het
Maml2 AGC AGCCGC 9: 13,621,254 probably benign Het
Maml2 AGC AGCCGC 9: 13,621,275 probably benign Het
Maml2 GCA GCACCA 9: 13,621,276 probably benign Het
Nsun7 T A 5: 66,276,541 L178* probably null Het
Olfr775 A T 10: 129,250,995 I154F probably benign Het
Olfr786 A G 10: 129,436,931 N40D probably damaging Het
Olfr972 A T 9: 39,874,082 D269V probably benign Het
Orc6 T A 8: 85,303,408 S136T possibly damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Plxnc1 A G 10: 94,943,515 probably null Het
Prkdc G A 16: 15,806,096 D3308N probably null Het
Rtkn2 G A 10: 67,979,813 probably null Het
Sele T C 1: 164,050,694 S201P possibly damaging Het
Shq1 A G 6: 100,671,045 F6S probably damaging Het
Sparc A T 11: 55,409,971 I5N probably damaging Het
Srm T C 4: 148,593,945 I238T probably damaging Het
Stx2 C A 5: 128,993,563 E97* probably null Het
Sugp2 C T 8: 70,252,072 P753L probably benign Het
Tenm2 A T 11: 36,047,116 S1578T probably damaging Het
Tff3 T C 17: 31,129,570 T3A probably benign Het
Tmem38a C T 8: 72,572,120 A6V probably benign Het
Trbv16 G A 6: 41,151,995 A38T not run Het
Trim30a G A 7: 104,411,397 Q391* probably null Het
Ttn T G 2: 76,776,371 Y18065S probably damaging Het
Vmn2r24 T A 6: 123,780,479 M102K probably benign Het
Vmn2r69 G T 7: 85,407,116 H605N probably benign Het
Washc1 T A 17: 66,119,060 M451K possibly damaging Het
Washc3 G T 10: 88,216,075 probably null Het
Washc5 A T 15: 59,368,459 Y112N probably damaging Het
Zbtb40 T A 4: 137,017,327 T261S probably benign Het
Other mutations in Ubr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Ubr5 APN 15 37984036 missense probably damaging 1.00
IGL00548:Ubr5 APN 15 38004321 missense probably benign 0.11
IGL00675:Ubr5 APN 15 38018284 missense possibly damaging 0.84
IGL00770:Ubr5 APN 15 38006541 missense probably benign 0.27
IGL00774:Ubr5 APN 15 38006541 missense probably benign 0.27
IGL00919:Ubr5 APN 15 38040842 missense probably damaging 1.00
IGL00962:Ubr5 APN 15 37985934 missense probably damaging 1.00
IGL01328:Ubr5 APN 15 37981523 missense possibly damaging 0.82
IGL01359:Ubr5 APN 15 37973006 missense probably damaging 0.96
IGL01394:Ubr5 APN 15 38009631 missense possibly damaging 0.90
IGL01674:Ubr5 APN 15 37998379 missense probably damaging 1.00
IGL01981:Ubr5 APN 15 37996598 missense probably benign 0.08
IGL01993:Ubr5 APN 15 37973012 missense probably damaging 0.99
IGL02159:Ubr5 APN 15 37991379 splice site probably benign
IGL02252:Ubr5 APN 15 38024894 missense probably damaging 1.00
IGL02442:Ubr5 APN 15 38037901 missense possibly damaging 0.95
IGL02502:Ubr5 APN 15 38030689 missense probably benign 0.01
IGL02503:Ubr5 APN 15 38018320 missense possibly damaging 0.90
IGL02503:Ubr5 APN 15 38018314 missense probably damaging 0.99
IGL02546:Ubr5 APN 15 38008747 missense probably benign 0.00
IGL02556:Ubr5 APN 15 38002448 missense probably benign 0.18
IGL02647:Ubr5 APN 15 37992082 missense probably damaging 0.99
IGL02679:Ubr5 APN 15 38002314 missense probably benign 0.36
IGL02726:Ubr5 APN 15 38000562 splice site probably benign
IGL02884:Ubr5 APN 15 37998376 missense probably damaging 1.00
IGL02972:Ubr5 APN 15 38041952 missense probably damaging 1.00
IGL03000:Ubr5 APN 15 38024852 missense probably damaging 0.99
IGL03028:Ubr5 APN 15 38047593 missense probably benign 0.00
IGL03057:Ubr5 APN 15 38040906 splice site probably benign
IGL03085:Ubr5 APN 15 38029568 missense probably damaging 1.00
IGL03198:Ubr5 APN 15 38045720 missense probably damaging 1.00
IGL03368:Ubr5 APN 15 37998316 missense probably damaging 0.96
P0016:Ubr5 UTSW 15 38000578 missense probably damaging 1.00
PIT4142001:Ubr5 UTSW 15 38041909 missense probably damaging 0.98
R0133:Ubr5 UTSW 15 37996571 missense probably damaging 0.98
R0173:Ubr5 UTSW 15 38004675 missense probably damaging 1.00
R0234:Ubr5 UTSW 15 37968493 missense probably damaging 1.00
R0234:Ubr5 UTSW 15 37968493 missense probably damaging 1.00
R0314:Ubr5 UTSW 15 37997187 missense probably damaging 0.99
R0379:Ubr5 UTSW 15 38018957 missense probably benign 0.00
R0390:Ubr5 UTSW 15 38030672 missense probably benign 0.19
R0415:Ubr5 UTSW 15 37972980 missense probably damaging 0.98
R0531:Ubr5 UTSW 15 37991344 missense probably benign 0.34
R0650:Ubr5 UTSW 15 38030807 splice site probably benign
R0720:Ubr5 UTSW 15 37972991 missense probably damaging 0.98
R1183:Ubr5 UTSW 15 37997175 missense possibly damaging 0.71
R1302:Ubr5 UTSW 15 38041479 missense possibly damaging 0.91
R1442:Ubr5 UTSW 15 38014924 splice site probably benign
R1507:Ubr5 UTSW 15 37980870 missense probably damaging 1.00
R1575:Ubr5 UTSW 15 38040841 missense probably damaging 1.00
R1577:Ubr5 UTSW 15 38030730 missense possibly damaging 0.76
R1622:Ubr5 UTSW 15 38009113 unclassified probably benign
R1721:Ubr5 UTSW 15 38041846 missense probably benign 0.18
R1799:Ubr5 UTSW 15 37989377 missense probably damaging 1.00
R1840:Ubr5 UTSW 15 37980917 missense possibly damaging 0.51
R1867:Ubr5 UTSW 15 38041846 missense probably benign 0.18
R1868:Ubr5 UTSW 15 38041846 missense probably benign 0.18
R2065:Ubr5 UTSW 15 38040842 missense probably damaging 1.00
R2107:Ubr5 UTSW 15 37989302 missense probably benign 0.00
R2201:Ubr5 UTSW 15 38002299 missense possibly damaging 0.83
R2261:Ubr5 UTSW 15 37988284 missense probably damaging 0.99
R2441:Ubr5 UTSW 15 37989345 missense probably damaging 0.99
R2512:Ubr5 UTSW 15 38002319 missense probably damaging 1.00
R3008:Ubr5 UTSW 15 38030845 missense probably benign
R3412:Ubr5 UTSW 15 38004235 splice site probably benign
R3898:Ubr5 UTSW 15 37997739 missense probably benign 0.02
R3900:Ubr5 UTSW 15 38019242 missense probably damaging 1.00
R4032:Ubr5 UTSW 15 38024837 missense probably benign 0.22
R4352:Ubr5 UTSW 15 38041573 missense probably benign 0.31
R4362:Ubr5 UTSW 15 38078403 missense probably damaging 0.99
R4467:Ubr5 UTSW 15 38004336 missense probably damaging 1.00
R4507:Ubr5 UTSW 15 38013542 missense probably damaging 0.96
R4683:Ubr5 UTSW 15 38037967 missense probably damaging 1.00
R4771:Ubr5 UTSW 15 38018297 missense possibly damaging 0.50
R4878:Ubr5 UTSW 15 38006564 missense probably benign 0.01
R4999:Ubr5 UTSW 15 38009668 missense probably benign 0.06
R5057:Ubr5 UTSW 15 38004109 missense probably damaging 0.98
R5177:Ubr5 UTSW 15 38006517 missense probably benign 0.22
R5186:Ubr5 UTSW 15 37997916 missense probably damaging 0.99
R5378:Ubr5 UTSW 15 37989578 missense probably damaging 1.00
R5486:Ubr5 UTSW 15 38008739 missense probably benign 0.00
R5494:Ubr5 UTSW 15 38019281 missense possibly damaging 0.78
R5617:Ubr5 UTSW 15 38030657 missense possibly damaging 0.47
R5636:Ubr5 UTSW 15 37983996 missense probably damaging 1.00
R5655:Ubr5 UTSW 15 38015093 missense probably damaging 0.99
R5715:Ubr5 UTSW 15 38002233 missense probably benign 0.06
R5781:Ubr5 UTSW 15 38006541 missense probably benign 0.27
R6645:Ubr5 UTSW 15 38029506 missense probably damaging 1.00
R6774:Ubr5 UTSW 15 38015135 missense probably damaging 1.00
R6823:Ubr5 UTSW 15 37989598 missense probably benign 0.08
R6877:Ubr5 UTSW 15 38002570 missense probably damaging 0.98
R7105:Ubr5 UTSW 15 38008775 missense
R7166:Ubr5 UTSW 15 37976145 missense
R7514:Ubr5 UTSW 15 37988237 missense
R7523:Ubr5 UTSW 15 38004055 missense
R7631:Ubr5 UTSW 15 38029507 missense
R7709:Ubr5 UTSW 15 37979832 missense probably null
R7710:Ubr5 UTSW 15 37979832 missense probably null
R7712:Ubr5 UTSW 15 37979832 missense probably null
R7816:Ubr5 UTSW 15 37979832 missense probably null
R7817:Ubr5 UTSW 15 37979832 missense probably null
R7821:Ubr5 UTSW 15 37997187 missense probably damaging 0.96
R7824:Ubr5 UTSW 15 37991322 missense probably damaging 0.97
R7841:Ubr5 UTSW 15 37980906 missense
R7869:Ubr5 UTSW 15 37979832 missense probably null
R7896:Ubr5 UTSW 15 38041573 missense probably benign 0.31
R8191:Ubr5 UTSW 15 38006507 missense
RF024:Ubr5 UTSW 15 38028652 missense
X0024:Ubr5 UTSW 15 37992060 missense probably damaging 1.00
Z1177:Ubr5 UTSW 15 38040755 missense
Predicted Primers PCR Primer
(F):5'- GCACTTATGTATTTGAAGACACCAC -3'
(R):5'- AACAAAACCGCGAGTTCCTG -3'

Sequencing Primer
(F):5'- AACCTAAGGCCTCTGGGAG -3'
(R):5'- AGAGCTGTCTGACCTTGCAG -3'
Posted On2019-11-26