Incidental Mutation 'R7803:Acta2'
ID600646
Institutional Source Beutler Lab
Gene Symbol Acta2
Ensembl Gene ENSMUSG00000035783
Gene Nameactin, alpha 2, smooth muscle, aorta
SynonymsalphaSMA, SMalphaA, 0610041G09Rik, Actvs, a-SMA
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.257) question?
Stock #R7803 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location34241090-34255336 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 34243418 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 297 (A297S)
Ref Sequence ENSEMBL: ENSMUSP00000048218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039631] [ENSMUST00000054956] [ENSMUST00000119603]
Predicted Effect probably benign
Transcript: ENSMUST00000039631
AA Change: A297S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000048218
Gene: ENSMUSG00000035783
AA Change: A297S

DomainStartEndE-ValueType
ACTIN 7 377 9.92e-237 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000054956
SMART Domains Protein: ENSMUSP00000059927
Gene: ENSMUSG00000024776

DomainStartEndE-ValueType
Pfam:USP8_dimer 19 132 3e-21 PFAM
coiled coil region 149 176 N/A INTRINSIC
JAB_MPN 268 394 4.29e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119603
SMART Domains Protein: ENSMUSP00000112938
Gene: ENSMUSG00000024776

DomainStartEndE-ValueType
Pfam:USP8_dimer 19 132 3.9e-21 PFAM
coiled coil region 149 176 N/A INTRINSIC
JAB_MPN 268 394 4.29e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the actin family of proteins, which are highly conserved proteins that play a role in cell motility, structure and integrity. Alpha, beta and gamma actin isoforms have been identified, with alpha actins being a major constituent of the contractile apparatus, while beta and gamma actins are involved in the regulation of cell motility. This actin is an alpha actin that is found in skeletal muscle. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired vascular contractility and blood pressure homeostasis, increased blood-retina barrier permeability, and reduced retinal cone and rod function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ada A G 2: 163,735,368 Y67H probably benign Het
Adcy9 A G 16: 4,304,380 I839T probably benign Het
Arg1 C T 10: 24,916,791 V182I possibly damaging Het
Cbx7 G A 15: 79,933,823 T26M unknown Het
Ceacam5 A G 7: 17,759,392 Y780C probably damaging Het
Ces2h A G 8: 105,018,400 M389V probably benign Het
Chst11 A T 10: 83,191,186 E149V possibly damaging Het
Clstn1 T C 4: 149,631,871 W265R probably damaging Het
Col4a4 A G 1: 82,489,698 probably null Het
Csrp3 T G 7: 48,833,797 K119T probably benign Het
Ddx39 T C 8: 83,719,600 probably null Het
Ddx41 A G 13: 55,531,921 I437T probably damaging Het
Fbln5 A T 12: 101,761,818 D282E probably damaging Het
Folh1 G A 7: 86,726,098 T527I probably damaging Het
Gch1 T A 14: 47,188,961 T103S probably benign Het
Gm2022 T A 12: 87,895,499 C44S probably benign Het
Gm906 A G 13: 50,246,190 V700A probably benign Het
Gpr149 A G 3: 62,530,715 S674P probably damaging Het
Hecw1 G T 13: 14,234,342 R1127S probably benign Het
Hmcn1 A T 1: 150,770,279 C723S probably benign Het
Impg2 T C 16: 56,267,150 S1111P probably damaging Het
Insl3 T C 8: 71,689,340 L28P probably damaging Het
Kifc1 T C 17: 33,884,740 D203G probably benign Het
Kmt2d A T 15: 98,862,923 S849T unknown Het
Krt33b A G 11: 100,025,258 probably null Het
Lpin3 A G 2: 160,895,390 D119G possibly damaging Het
Maml2 AGC AGCCGC 9: 13,621,254 probably benign Het
Maml2 AGC AGCCGC 9: 13,621,275 probably benign Het
Maml2 GCA GCACCA 9: 13,621,276 probably benign Het
Nsun7 T A 5: 66,276,541 L178* probably null Het
Olfr775 A T 10: 129,250,995 I154F probably benign Het
Olfr786 A G 10: 129,436,931 N40D probably damaging Het
Olfr972 A T 9: 39,874,082 D269V probably benign Het
Orc6 T A 8: 85,303,408 S136T possibly damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Plxnc1 A G 10: 94,943,515 probably null Het
Prkdc G A 16: 15,806,096 D3308N probably null Het
Rtkn2 G A 10: 67,979,813 probably null Het
Sele T C 1: 164,050,694 S201P possibly damaging Het
Shq1 A G 6: 100,671,045 F6S probably damaging Het
Sparc A T 11: 55,409,971 I5N probably damaging Het
Srm T C 4: 148,593,945 I238T probably damaging Het
Stx2 C A 5: 128,993,563 E97* probably null Het
Sugp2 C T 8: 70,252,072 P753L probably benign Het
Tenm2 A T 11: 36,047,116 S1578T probably damaging Het
Tff3 T C 17: 31,129,570 T3A probably benign Het
Tmem38a C T 8: 72,572,120 A6V probably benign Het
Trbv16 G A 6: 41,151,995 A38T not run Het
Trim30a G A 7: 104,411,397 Q391* probably null Het
Ttn T G 2: 76,776,371 Y18065S probably damaging Het
Ubr5 G A 15: 37,979,832 A2434V probably null Het
Vmn2r24 T A 6: 123,780,479 M102K probably benign Het
Vmn2r69 G T 7: 85,407,116 H605N probably benign Het
Washc1 T A 17: 66,119,060 M451K possibly damaging Het
Washc3 G T 10: 88,216,075 probably null Het
Washc5 A T 15: 59,368,459 Y112N probably damaging Het
Zbtb40 T A 4: 137,017,327 T261S probably benign Het
Other mutations in Acta2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01660:Acta2 APN 19 34251791 missense probably damaging 0.98
IGL01802:Acta2 APN 19 34243436 missense possibly damaging 0.91
IGL01945:Acta2 APN 19 34251854 missense probably benign 0.03
IGL02136:Acta2 APN 19 34251830 missense probably damaging 1.00
IGL03114:Acta2 APN 19 34244910 critical splice donor site probably null
R0648:Acta2 UTSW 19 34248534 missense probably benign
R1393:Acta2 UTSW 19 34241792 missense probably damaging 1.00
R1597:Acta2 UTSW 19 34252583 splice site probably benign
R2045:Acta2 UTSW 19 34243399 missense probably damaging 1.00
R2338:Acta2 UTSW 19 34248541 splice site probably benign
R3113:Acta2 UTSW 19 34243352 missense probably benign
R3940:Acta2 UTSW 19 34243480 missense possibly damaging 0.94
R3955:Acta2 UTSW 19 34251726 splice site probably benign
R4765:Acta2 UTSW 19 34246152 missense probably damaging 1.00
R4826:Acta2 UTSW 19 34251823 nonsense probably null
R6453:Acta2 UTSW 19 34246657 missense probably damaging 1.00
R6754:Acta2 UTSW 19 34244983 missense probably damaging 1.00
R6941:Acta2 UTSW 19 34252522 missense probably damaging 1.00
R7311:Acta2 UTSW 19 34241786 missense probably damaging 1.00
R7461:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7463:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7464:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7536:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7537:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7605:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7609:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7610:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7611:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7613:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7626:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7627:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7872:Acta2 UTSW 19 34243439 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAGAGCCTGTTAAACTGCC -3'
(R):5'- AGTTTCTAGTTCATGATGCCTGC -3'

Sequencing Primer
(F):5'- GAGAGCCTGTTAAACTGCCTCTTAG -3'
(R):5'- TAGTTCATGATGCCTGCCAGCC -3'
Posted On2019-11-26