Incidental Mutation 'R7804:Pi15'
ID600647
Institutional Source Beutler Lab
Gene Symbol Pi15
Ensembl Gene ENSMUSG00000067780
Gene Namepeptidase inhibitor 15
SynonymsP25TI, SugarCrisp, P24TI
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7804 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location17601901-17630939 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 17624913 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 251 (C251*)
Ref Sequence ENSEMBL: ENSMUSP00000085826 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088476]
Predicted Effect probably null
Transcript: ENSMUST00000088476
AA Change: C251*
SMART Domains Protein: ENSMUSP00000085826
Gene: ENSMUSG00000067780
AA Change: C251*

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
SCP 76 230 9.32e-37 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a trypsin inhibitor. The protein shares similarity to insect venom allergens, mammalian testis-specific proteins and plant pathogenesis-related proteins. It is frequently expressed in human neuroblastoma and glioblastoma cell lines, and thus may play a role in the central nervous system. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933415A04Rik GTGTGTATGTGT GTGTGT 11: 43,587,414 probably benign Het
Ago4 A T 4: 126,512,630 C296S probably benign Het
Apbb1 A G 7: 105,566,600 L401P probably damaging Het
Cacnb2 C A 2: 14,968,037 P252T probably benign Het
Ctnna2 C T 6: 77,641,374 V202I probably benign Het
Dapk1 A T 13: 60,725,339 I352F probably benign Het
Dexi T C 16: 10,542,485 D69G possibly damaging Het
Dgcr14 T A 16: 17,911,167 I47F probably damaging Het
Dlg5 T C 14: 24,165,320 E645G possibly damaging Het
Dnah3 A G 7: 119,952,618 I2826T probably damaging Het
Dnah3 A G 7: 120,011,012 W1734R probably damaging Het
Dtna A G 18: 23,595,609 K287R probably damaging Het
Elovl5 A G 9: 77,979,823 probably null Het
Fam222b C A 11: 78,154,153 P180Q probably benign Het
Fat3 C T 9: 15,990,592 V3046I probably benign Het
Fem1a A G 17: 56,258,068 D387G probably damaging Het
Frmd5 A G 2: 121,591,744 Y33H probably damaging Het
Gucy2g A T 19: 55,228,152 L464H probably benign Het
Ints2 T C 11: 86,212,663 E1189G possibly damaging Het
Itgb4 T C 11: 116,003,684 V1355A probably damaging Het
Lepr A T 4: 101,782,586 S750C probably damaging Het
Lingo1 T C 9: 56,619,514 D603G probably benign Het
Map4k3 A C 17: 80,615,070 V474G probably damaging Het
Myl4 T A 11: 104,584,961 V167E probably damaging Het
Naa25 T C 5: 121,424,589 V478A probably benign Het
Neurl4 T A 11: 69,905,874 L487H probably benign Het
Nkx2-9 C T 12: 56,612,132 R99H probably damaging Het
Olfr1215 C G 2: 89,001,511 R259P unknown Het
Olfr686 A T 7: 105,204,160 M61K probably damaging Het
Olfr809 A G 10: 129,776,222 I103V probably benign Het
Pcdhga9 A G 18: 37,738,079 I320M probably damaging Het
Pkhd1l1 A T 15: 44,597,138 K4248* probably null Het
Prkg1 C T 19: 30,578,632 V625I probably benign Het
Prkg1 G A 19: 30,624,770 A362V possibly damaging Het
Prol1 C T 5: 88,328,405 T218I unknown Het
Rev3l T A 10: 39,823,485 I1326K probably benign Het
Shank1 C A 7: 44,312,884 R60S unknown Het
Slc24a2 A G 4: 86,991,537 V648A probably damaging Het
Slc35d3 T C 10: 19,849,370 T247A probably damaging Het
Specc1 C T 11: 62,205,397 T895I probably damaging Het
Spta1 A G 1: 174,195,905 E626G possibly damaging Het
Syngr2 C A 11: 117,812,575 S72R possibly damaging Het
Synj2 T A 17: 6,019,534 L490Q unknown Het
Tbc1d9 T C 8: 83,236,712 L351P possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Themis3 G A 17: 66,555,610 T451I probably benign Het
Tia1 T C 6: 86,424,382 S146P probably benign Het
Tpp2 T A 1: 43,983,281 N946K probably benign Het
Tpr A T 1: 150,432,559 R1688S probably damaging Het
Trav12-1 A G 14: 53,538,531 Q47R possibly damaging Het
Ttll9 G A 2: 153,002,358 probably null Het
Ttn G A 2: 76,707,241 T34781M possibly damaging Het
V1ra8 A G 6: 90,203,316 Y167C probably damaging Het
Vegfb T C 19: 6,986,339 D84G probably damaging Het
Vmn2r14 A T 5: 109,220,458 L223M probably benign Het
Wdr26 A G 1: 181,182,822 I554T probably damaging Het
Other mutations in Pi15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Pi15 APN 1 17621523 missense probably damaging 1.00
IGL00844:Pi15 APN 1 17621540 splice site probably benign
IGL03388:Pi15 APN 1 17602777 missense probably benign
R0554:Pi15 UTSW 1 17621648 missense probably benign 0.06
R0578:Pi15 UTSW 1 17602849 nonsense probably null
R1524:Pi15 UTSW 1 17619852 missense probably benign 0.01
R1665:Pi15 UTSW 1 17621502 missense probably damaging 1.00
R1791:Pi15 UTSW 1 17602721 missense probably benign 0.02
R4767:Pi15 UTSW 1 17602766 missense probably benign
R7850:Pi15 UTSW 1 17602881 nonsense probably null
R7933:Pi15 UTSW 1 17602881 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTGGCGATTTTAATAGCAATAGGC -3'
(R):5'- GCAACAACTGTGGGTACATAGC -3'

Sequencing Primer
(F):5'- GGAATCTGTCCTTGAGGTAAG -3'
(R):5'- ACTGTGGGTACATAGCTACATATGTG -3'
Posted On2019-11-26