Incidental Mutation 'R7804:Wdr26'
ID600651
Institutional Source Beutler Lab
Gene Symbol Wdr26
Ensembl Gene ENSMUSG00000038733
Gene NameWD repeat domain 26
SynonymsGid7, 1600024A01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.902) question?
Stock #R7804 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location181173228-181211552 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 181182822 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 554 (I554T)
Ref Sequence ENSEMBL: ENSMUSP00000124592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000162819] [ENSMUST00000162963]
Predicted Effect probably benign
Transcript: ENSMUST00000036329
SMART Domains Protein: ENSMUSP00000045177
Gene: ENSMUSG00000038733

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
low complexity region 43 70 N/A INTRINSIC
low complexity region 71 83 N/A INTRINSIC
LisH 100 132 9.73e-1 SMART
Blast:CTLH 133 183 6e-28 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000159290
AA Change: I30T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123863
Gene: ENSMUSG00000038733
AA Change: I30T

DomainStartEndE-ValueType
WD40 14 56 2.77e-1 SMART
WD40 59 99 3.83e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159673
AA Change: I57T

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000125023
Gene: ENSMUSG00000038733
AA Change: I57T

DomainStartEndE-ValueType
Blast:WD40 2 38 4e-12 BLAST
WD40 41 83 2.77e-1 SMART
WD40 86 126 3.83e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162819
AA Change: I554T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124592
Gene: ENSMUSG00000038733
AA Change: I554T

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
low complexity region 46 73 N/A INTRINSIC
low complexity region 74 86 N/A INTRINSIC
LisH 103 135 9.73e-1 SMART
CTLH 136 211 2.41e-5 SMART
low complexity region 276 287 N/A INTRINSIC
WD40 324 363 4.76e-6 SMART
WD40 370 411 1.35e-5 SMART
WD40 414 454 2.12e-3 SMART
WD40 537 579 2.77e-1 SMART
WD40 582 622 3.83e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162963
AA Change: I538T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124186
Gene: ENSMUSG00000038733
AA Change: I538T

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
low complexity region 46 73 N/A INTRINSIC
low complexity region 74 86 N/A INTRINSIC
LisH 103 135 9.73e-1 SMART
CTLH 136 195 4.97e-7 SMART
low complexity region 260 271 N/A INTRINSIC
WD40 308 347 4.76e-6 SMART
WD40 354 395 1.35e-5 SMART
WD40 398 438 2.12e-3 SMART
WD40 521 563 2.77e-1 SMART
WD40 566 606 3.83e-10 SMART
Meta Mutation Damage Score 0.9034 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 95% (55/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Two transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933415A04Rik GTGTGTATGTGT GTGTGT 11: 43,587,414 probably benign Het
Ago4 A T 4: 126,512,630 C296S probably benign Het
Apbb1 A G 7: 105,566,600 L401P probably damaging Het
Cacnb2 C A 2: 14,968,037 P252T probably benign Het
Ctnna2 C T 6: 77,641,374 V202I probably benign Het
Dapk1 A T 13: 60,725,339 I352F probably benign Het
Dexi T C 16: 10,542,485 D69G possibly damaging Het
Dgcr14 T A 16: 17,911,167 I47F probably damaging Het
Dlg5 T C 14: 24,165,320 E645G possibly damaging Het
Dnah3 A G 7: 119,952,618 I2826T probably damaging Het
Dnah3 A G 7: 120,011,012 W1734R probably damaging Het
Dtna A G 18: 23,595,609 K287R probably damaging Het
Elovl5 A G 9: 77,979,823 probably null Het
Fam222b C A 11: 78,154,153 P180Q probably benign Het
Fat3 C T 9: 15,990,592 V3046I probably benign Het
Fem1a A G 17: 56,258,068 D387G probably damaging Het
Frmd5 A G 2: 121,591,744 Y33H probably damaging Het
Gucy2g A T 19: 55,228,152 L464H probably benign Het
Ints2 T C 11: 86,212,663 E1189G possibly damaging Het
Itgb4 T C 11: 116,003,684 V1355A probably damaging Het
Lepr A T 4: 101,782,586 S750C probably damaging Het
Lingo1 T C 9: 56,619,514 D603G probably benign Het
Map4k3 A C 17: 80,615,070 V474G probably damaging Het
Myl4 T A 11: 104,584,961 V167E probably damaging Het
Naa25 T C 5: 121,424,589 V478A probably benign Het
Neurl4 T A 11: 69,905,874 L487H probably benign Het
Nkx2-9 C T 12: 56,612,132 R99H probably damaging Het
Olfr1215 C G 2: 89,001,511 R259P unknown Het
Olfr686 A T 7: 105,204,160 M61K probably damaging Het
Olfr809 A G 10: 129,776,222 I103V probably benign Het
Pcdhga9 A G 18: 37,738,079 I320M probably damaging Het
Pi15 T A 1: 17,624,913 C251* probably null Het
Pkhd1l1 A T 15: 44,597,138 K4248* probably null Het
Prkg1 C T 19: 30,578,632 V625I probably benign Het
Prkg1 G A 19: 30,624,770 A362V possibly damaging Het
Prol1 C T 5: 88,328,405 T218I unknown Het
Ptpro G A 6: 137,399,601 probably null Het
Rev3l T A 10: 39,823,485 I1326K probably benign Het
Shank1 C A 7: 44,312,884 R60S unknown Het
Slc24a2 A G 4: 86,991,537 V648A probably damaging Het
Slc35d3 T C 10: 19,849,370 T247A probably damaging Het
Specc1 C T 11: 62,205,397 T895I probably damaging Het
Spta1 A G 1: 174,195,905 E626G possibly damaging Het
Syngr2 C A 11: 117,812,575 S72R possibly damaging Het
Synj2 T A 17: 6,019,534 L490Q unknown Het
Tbc1d9 T C 8: 83,236,712 L351P possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Themis3 G A 17: 66,555,610 T451I probably benign Het
Tia1 T C 6: 86,424,382 S146P probably benign Het
Tpp2 T A 1: 43,983,281 N946K probably benign Het
Tpr A T 1: 150,432,559 R1688S probably damaging Het
Trav12-1 A G 14: 53,538,531 Q47R possibly damaging Het
Ttll9 G A 2: 153,002,358 probably null Het
Ttn G A 2: 76,707,241 T34781M possibly damaging Het
V1ra8 A G 6: 90,203,316 Y167C probably damaging Het
Vegfb T C 19: 6,986,339 D84G probably damaging Het
Vmn2r14 A T 5: 109,220,458 L223M probably benign Het
Other mutations in Wdr26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01625:Wdr26 APN 1 181191816 missense possibly damaging 0.86
IGL01941:Wdr26 APN 1 181211070 splice site probably benign
IGL02612:Wdr26 APN 1 181177796 utr 3 prime probably benign
IGL02660:Wdr26 APN 1 181198898 missense probably damaging 1.00
IGL02685:Wdr26 APN 1 181183780 missense possibly damaging 0.64
IGL02884:Wdr26 APN 1 181182784 missense probably damaging 1.00
R0396:Wdr26 UTSW 1 181180651 intron probably benign
R0453:Wdr26 UTSW 1 181182879 nonsense probably null
R0530:Wdr26 UTSW 1 181186070 splice site probably null
R0729:Wdr26 UTSW 1 181185905 splice site probably null
R1170:Wdr26 UTSW 1 181181294 splice site probably benign
R1466:Wdr26 UTSW 1 181185934 splice site probably benign
R1830:Wdr26 UTSW 1 181191775 missense probably damaging 1.00
R2883:Wdr26 UTSW 1 181211120 missense probably damaging 0.99
R4090:Wdr26 UTSW 1 181203114 missense probably damaging 1.00
R4097:Wdr26 UTSW 1 181182787 missense probably benign 0.00
R4953:Wdr26 UTSW 1 181197651 missense probably damaging 1.00
R5223:Wdr26 UTSW 1 181187686 missense probably benign 0.07
R5834:Wdr26 UTSW 1 181203147 missense probably damaging 1.00
R5884:Wdr26 UTSW 1 181187541 intron probably benign
R6174:Wdr26 UTSW 1 181191868 missense probably damaging 1.00
R6334:Wdr26 UTSW 1 181203206
R7161:Wdr26 UTSW 1 181203130 missense probably damaging 1.00
R7255:Wdr26 UTSW 1 181181324 missense probably benign 0.24
R7406:Wdr26 UTSW 1 181187675 missense probably damaging 1.00
R7815:Wdr26 UTSW 1 181209073 missense probably benign 0.28
R8717:Wdr26 UTSW 1 181184348 missense not run
Predicted Primers PCR Primer
(F):5'- GGTTCCATCACCAACAATACATAGG -3'
(R):5'- ACTGTATATGCCTGTACTTAGGAG -3'

Sequencing Primer
(F):5'- TTAAGGACTCAAGCCACCCC -3'
(R):5'- CCGTTCTACAGAATGAGTTCCAGG -3'
Posted On2019-11-26