Incidental Mutation 'R7804:Cacnb2'
ID600652
Institutional Source Beutler Lab
Gene Symbol Cacnb2
Ensembl Gene ENSMUSG00000057914
Gene Namecalcium channel, voltage-dependent, beta 2 subunit
SynonymsCchb2, Cavbeta2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7804 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location14603088-14987908 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 14968037 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 252 (P252T)
Ref Sequence ENSEMBL: ENSMUSP00000110371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114719] [ENSMUST00000114723] [ENSMUST00000193800]
Predicted Effect probably benign
Transcript: ENSMUST00000114719
AA Change: P208T

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000110367
Gene: ENSMUSG00000057914
AA Change: P208T

DomainStartEndE-ValueType
Pfam:VGCC_beta4Aa_N 24 65 1.7e-26 PFAM
SH3 69 133 2.42e-2 SMART
low complexity region 149 161 N/A INTRINSIC
GuKc 232 414 6.11e-38 SMART
low complexity region 419 448 N/A INTRINSIC
low complexity region 546 561 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114723
AA Change: P252T

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000110371
Gene: ENSMUSG00000057914
AA Change: P252T

DomainStartEndE-ValueType
low complexity region 50 61 N/A INTRINSIC
Pfam:VGCC_beta4Aa_N 68 109 2.7e-25 PFAM
SH3 113 177 2.42e-2 SMART
low complexity region 193 205 N/A INTRINSIC
GuKc 276 458 6.11e-38 SMART
low complexity region 463 492 N/A INTRINSIC
low complexity region 590 605 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193522
Predicted Effect probably benign
Transcript: ENSMUST00000193800
AA Change: P202T

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000141221
Gene: ENSMUSG00000057914
AA Change: P202T

DomainStartEndE-ValueType
Pfam:VGCC_beta4Aa_N 18 59 3.2e-27 PFAM
SH3 63 127 2.42e-2 SMART
low complexity region 143 155 N/A INTRINSIC
GuKc 226 408 6.11e-38 SMART
low complexity region 413 442 N/A INTRINSIC
low complexity region 540 555 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 95% (55/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of a voltage-dependent calcium channel protein that is a member of the voltage-gated calcium channel superfamily. The gene product was originally identified as an antigen target in Lambert-Eaton myasthenic syndrome, an autoimmune disorder. Mutations in this gene are associated with Brugada syndrome. Alternatively spliced variants encoding different isoforms have been described. [provided by RefSeq, Feb 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit lethality at E10.5 with growth retardation, abnormal yolk vasculature and abnormal cardiac development and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933415A04Rik GTGTGTATGTGT GTGTGT 11: 43,587,414 probably benign Het
Ago4 A T 4: 126,512,630 C296S probably benign Het
Apbb1 A G 7: 105,566,600 L401P probably damaging Het
Ctnna2 C T 6: 77,641,374 V202I probably benign Het
Dapk1 A T 13: 60,725,339 I352F probably benign Het
Dexi T C 16: 10,542,485 D69G possibly damaging Het
Dgcr14 T A 16: 17,911,167 I47F probably damaging Het
Dlg5 T C 14: 24,165,320 E645G possibly damaging Het
Dnah3 A G 7: 119,952,618 I2826T probably damaging Het
Dnah3 A G 7: 120,011,012 W1734R probably damaging Het
Dtna A G 18: 23,595,609 K287R probably damaging Het
Elovl5 A G 9: 77,979,823 probably null Het
Fam222b C A 11: 78,154,153 P180Q probably benign Het
Fat3 C T 9: 15,990,592 V3046I probably benign Het
Fem1a A G 17: 56,258,068 D387G probably damaging Het
Frmd5 A G 2: 121,591,744 Y33H probably damaging Het
Gucy2g A T 19: 55,228,152 L464H probably benign Het
Ints2 T C 11: 86,212,663 E1189G possibly damaging Het
Itgb4 T C 11: 116,003,684 V1355A probably damaging Het
Lepr A T 4: 101,782,586 S750C probably damaging Het
Lingo1 T C 9: 56,619,514 D603G probably benign Het
Map4k3 A C 17: 80,615,070 V474G probably damaging Het
Myl4 T A 11: 104,584,961 V167E probably damaging Het
Naa25 T C 5: 121,424,589 V478A probably benign Het
Neurl4 T A 11: 69,905,874 L487H probably benign Het
Nkx2-9 C T 12: 56,612,132 R99H probably damaging Het
Olfr1215 C G 2: 89,001,511 R259P unknown Het
Olfr686 A T 7: 105,204,160 M61K probably damaging Het
Olfr809 A G 10: 129,776,222 I103V probably benign Het
Pcdhga9 A G 18: 37,738,079 I320M probably damaging Het
Pi15 T A 1: 17,624,913 C251* probably null Het
Pkhd1l1 A T 15: 44,597,138 K4248* probably null Het
Prkg1 C T 19: 30,578,632 V625I probably benign Het
Prkg1 G A 19: 30,624,770 A362V possibly damaging Het
Prol1 C T 5: 88,328,405 T218I unknown Het
Ptpro G A 6: 137,399,601 probably null Het
Rev3l T A 10: 39,823,485 I1326K probably benign Het
Shank1 C A 7: 44,312,884 R60S unknown Het
Slc24a2 A G 4: 86,991,537 V648A probably damaging Het
Slc35d3 T C 10: 19,849,370 T247A probably damaging Het
Specc1 C T 11: 62,205,397 T895I probably damaging Het
Spta1 A G 1: 174,195,905 E626G possibly damaging Het
Syngr2 C A 11: 117,812,575 S72R possibly damaging Het
Synj2 T A 17: 6,019,534 L490Q unknown Het
Tbc1d9 T C 8: 83,236,712 L351P possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Themis3 G A 17: 66,555,610 T451I probably benign Het
Tia1 T C 6: 86,424,382 S146P probably benign Het
Tpp2 T A 1: 43,983,281 N946K probably benign Het
Tpr A T 1: 150,432,559 R1688S probably damaging Het
Trav12-1 A G 14: 53,538,531 Q47R possibly damaging Het
Ttll9 G A 2: 153,002,358 probably null Het
Ttn G A 2: 76,707,241 T34781M possibly damaging Het
V1ra8 A G 6: 90,203,316 Y167C probably damaging Het
Vegfb T C 19: 6,986,339 D84G probably damaging Het
Vmn2r14 A T 5: 109,220,458 L223M probably benign Het
Wdr26 A G 1: 181,182,822 I554T probably damaging Het
Other mutations in Cacnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Cacnb2 APN 2 14984270 missense possibly damaging 0.95
IGL01806:Cacnb2 APN 2 14614268 missense probably damaging 1.00
IGL01939:Cacnb2 APN 2 14971569 missense probably benign 0.16
IGL02941:Cacnb2 APN 2 14958829 missense probably benign 0.00
PIT1430001:Cacnb2 UTSW 2 14971601 nonsense probably null
PIT4498001:Cacnb2 UTSW 2 14874819 nonsense probably null
PIT4508001:Cacnb2 UTSW 2 14984419 missense probably benign 0.00
R0095:Cacnb2 UTSW 2 14958775 missense probably damaging 1.00
R0731:Cacnb2 UTSW 2 14985706 missense possibly damaging 0.95
R1521:Cacnb2 UTSW 2 14614352 missense probably benign 0.18
R1829:Cacnb2 UTSW 2 14985964 missense possibly damaging 0.89
R2174:Cacnb2 UTSW 2 14958767 missense probably benign 0.21
R2471:Cacnb2 UTSW 2 14984314 missense probably damaging 1.00
R2473:Cacnb2 UTSW 2 14984314 missense probably damaging 1.00
R3801:Cacnb2 UTSW 2 14824263 missense possibly damaging 0.85
R3831:Cacnb2 UTSW 2 14981425 missense probably damaging 1.00
R3832:Cacnb2 UTSW 2 14981425 missense probably damaging 1.00
R3833:Cacnb2 UTSW 2 14981425 missense probably damaging 1.00
R3981:Cacnb2 UTSW 2 14604503 missense probably benign
R4231:Cacnb2 UTSW 2 14981440 missense probably damaging 1.00
R4426:Cacnb2 UTSW 2 14975215 nonsense probably null
R4569:Cacnb2 UTSW 2 14986000 missense possibly damaging 0.94
R4815:Cacnb2 UTSW 2 14874780 missense probably damaging 1.00
R4911:Cacnb2 UTSW 2 14981340 missense possibly damaging 0.83
R5189:Cacnb2 UTSW 2 14986038 missense possibly damaging 0.56
R6114:Cacnb2 UTSW 2 14975201 missense possibly damaging 0.88
R6158:Cacnb2 UTSW 2 14985601 missense possibly damaging 0.62
R6530:Cacnb2 UTSW 2 14975167 missense probably damaging 1.00
R6612:Cacnb2 UTSW 2 14975149 missense probably benign 0.41
R6882:Cacnb2 UTSW 2 14824299 missense probably benign 0.00
R6889:Cacnb2 UTSW 2 14986015 missense possibly damaging 0.55
R7820:Cacnb2 UTSW 2 14960666 missense probably damaging 1.00
R7971:Cacnb2 UTSW 2 14971598 missense possibly damaging 0.51
R7980:Cacnb2 UTSW 2 14604515 missense probably benign
R7993:Cacnb2 UTSW 2 14963920 missense probably benign 0.16
R8762:Cacnb2 UTSW 2 14967948 missense not run
Predicted Primers PCR Primer
(F):5'- CTCTGTGTAATAGACTGCACATTC -3'
(R):5'- GCTTCTGCTTTGCTACAGCAG -3'

Sequencing Primer
(F):5'- CTGCACATTCATGATAAATCTTCTGC -3'
(R):5'- CTACAGCAGCATGGAAAAGAAAC -3'
Posted On2019-11-26