Incidental Mutation 'R7804:Ttll9'
ID600656
Institutional Source Beutler Lab
Gene Symbol Ttll9
Ensembl Gene ENSMUSG00000074673
Gene Nametubulin tyrosine ligase-like family, member 9
Synonyms4930509O20Rik, 1700016F23Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R7804 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location152962485-153008482 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 153002358 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099197] [ENSMUST00000103155] [ENSMUST00000109801] [ENSMUST00000146626] [ENSMUST00000152158] [ENSMUST00000165343]
Predicted Effect probably null
Transcript: ENSMUST00000099197
SMART Domains Protein: ENSMUSP00000096803
Gene: ENSMUSG00000074673

DomainStartEndE-ValueType
Pfam:TTL 69 397 2.2e-87 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000103155
SMART Domains Protein: ENSMUSP00000099444
Gene: ENSMUSG00000074673

DomainStartEndE-ValueType
Pfam:TTL 67 397 5.3e-88 PFAM
low complexity region 452 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109801
SMART Domains Protein: ENSMUSP00000105426
Gene: ENSMUSG00000074673

DomainStartEndE-ValueType
Pfam:TTL 68 222 4.8e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146626
Predicted Effect probably benign
Transcript: ENSMUST00000152158
Predicted Effect probably benign
Transcript: ENSMUST00000165343
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933415A04Rik GTGTGTATGTGT GTGTGT 11: 43,587,414 probably benign Het
Ago4 A T 4: 126,512,630 C296S probably benign Het
Apbb1 A G 7: 105,566,600 L401P probably damaging Het
Cacnb2 C A 2: 14,968,037 P252T probably benign Het
Ctnna2 C T 6: 77,641,374 V202I probably benign Het
Dapk1 A T 13: 60,725,339 I352F probably benign Het
Dexi T C 16: 10,542,485 D69G possibly damaging Het
Dgcr14 T A 16: 17,911,167 I47F probably damaging Het
Dlg5 T C 14: 24,165,320 E645G possibly damaging Het
Dnah3 A G 7: 119,952,618 I2826T probably damaging Het
Dnah3 A G 7: 120,011,012 W1734R probably damaging Het
Dtna A G 18: 23,595,609 K287R probably damaging Het
Elovl5 A G 9: 77,979,823 probably null Het
Fam222b C A 11: 78,154,153 P180Q probably benign Het
Fat3 C T 9: 15,990,592 V3046I probably benign Het
Fem1a A G 17: 56,258,068 D387G probably damaging Het
Frmd5 A G 2: 121,591,744 Y33H probably damaging Het
Gucy2g A T 19: 55,228,152 L464H probably benign Het
Ints2 T C 11: 86,212,663 E1189G possibly damaging Het
Itgb4 T C 11: 116,003,684 V1355A probably damaging Het
Lepr A T 4: 101,782,586 S750C probably damaging Het
Lingo1 T C 9: 56,619,514 D603G probably benign Het
Map4k3 A C 17: 80,615,070 V474G probably damaging Het
Myl4 T A 11: 104,584,961 V167E probably damaging Het
Naa25 T C 5: 121,424,589 V478A probably benign Het
Neurl4 T A 11: 69,905,874 L487H probably benign Het
Nkx2-9 C T 12: 56,612,132 R99H probably damaging Het
Olfr1215 C G 2: 89,001,511 R259P unknown Het
Olfr686 A T 7: 105,204,160 M61K probably damaging Het
Olfr809 A G 10: 129,776,222 I103V probably benign Het
Pcdhga9 A G 18: 37,738,079 I320M probably damaging Het
Pi15 T A 1: 17,624,913 C251* probably null Het
Pkhd1l1 A T 15: 44,597,138 K4248* probably null Het
Prkg1 C T 19: 30,578,632 V625I probably benign Het
Prkg1 G A 19: 30,624,770 A362V possibly damaging Het
Prol1 C T 5: 88,328,405 T218I unknown Het
Rev3l T A 10: 39,823,485 I1326K probably benign Het
Shank1 C A 7: 44,312,884 R60S unknown Het
Slc24a2 A G 4: 86,991,537 V648A probably damaging Het
Slc35d3 T C 10: 19,849,370 T247A probably damaging Het
Specc1 C T 11: 62,205,397 T895I probably damaging Het
Spta1 A G 1: 174,195,905 E626G possibly damaging Het
Syngr2 C A 11: 117,812,575 S72R possibly damaging Het
Synj2 T A 17: 6,019,534 L490Q unknown Het
Tbc1d9 T C 8: 83,236,712 L351P possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Themis3 G A 17: 66,555,610 T451I probably benign Het
Tia1 T C 6: 86,424,382 S146P probably benign Het
Tpp2 T A 1: 43,983,281 N946K probably benign Het
Tpr A T 1: 150,432,559 R1688S probably damaging Het
Trav12-1 A G 14: 53,538,531 Q47R possibly damaging Het
Ttn G A 2: 76,707,241 T34781M possibly damaging Het
V1ra8 A G 6: 90,203,316 Y167C probably damaging Het
Vegfb T C 19: 6,986,339 D84G probably damaging Het
Vmn2r14 A T 5: 109,220,458 L223M probably benign Het
Wdr26 A G 1: 181,182,822 I554T probably damaging Het
Other mutations in Ttll9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:Ttll9 APN 2 152984260 missense probably damaging 0.99
IGL01107:Ttll9 APN 2 153002889 splice site probably benign
IGL01365:Ttll9 APN 2 153000134 missense possibly damaging 0.87
IGL01751:Ttll9 APN 2 152983105 missense probably damaging 0.99
IGL02264:Ttll9 APN 2 153000135 missense probably damaging 1.00
IGL02477:Ttll9 APN 2 153000197 missense possibly damaging 0.77
IGL02899:Ttll9 APN 2 153002951 missense probably damaging 0.99
I2288:Ttll9 UTSW 2 152972339 splice site probably benign
R0053:Ttll9 UTSW 2 152962506 utr 5 prime probably benign
R0116:Ttll9 UTSW 2 152983134 missense probably damaging 0.99
R0319:Ttll9 UTSW 2 153000098 splice site probably null
R0388:Ttll9 UTSW 2 153000179 missense probably benign
R0556:Ttll9 UTSW 2 152973606 critical splice donor site probably null
R0689:Ttll9 UTSW 2 152983127 missense probably benign 0.05
R1829:Ttll9 UTSW 2 153000236 missense possibly damaging 0.61
R2016:Ttll9 UTSW 2 153002294 missense probably damaging 1.00
R2144:Ttll9 UTSW 2 153003007 missense probably benign
R2229:Ttll9 UTSW 2 152983063 missense probably damaging 0.98
R2309:Ttll9 UTSW 2 152984145 missense probably damaging 1.00
R2314:Ttll9 UTSW 2 152983127 missense probably benign 0.05
R4191:Ttll9 UTSW 2 153003007 missense probably benign
R4539:Ttll9 UTSW 2 152994091 missense probably damaging 1.00
R4866:Ttll9 UTSW 2 153003000 missense probably benign 0.02
R5115:Ttll9 UTSW 2 152989590 intron probably benign
R5279:Ttll9 UTSW 2 152962544 missense possibly damaging 0.80
R5342:Ttll9 UTSW 2 152991652 missense possibly damaging 0.87
R5375:Ttll9 UTSW 2 152984224 missense probably benign 0.13
R5417:Ttll9 UTSW 2 153002992 missense probably benign
R5555:Ttll9 UTSW 2 152990100 critical splice donor site probably null
R5574:Ttll9 UTSW 2 152984248 missense possibly damaging 0.90
R5598:Ttll9 UTSW 2 152984314 missense probably damaging 1.00
R5613:Ttll9 UTSW 2 152973601 frame shift probably null
R6366:Ttll9 UTSW 2 152991605 missense probably damaging 0.99
R6409:Ttll9 UTSW 2 152999341 missense probably damaging 1.00
R6655:Ttll9 UTSW 2 153000303 splice site probably null
R6657:Ttll9 UTSW 2 152984262 missense probably damaging 1.00
R6766:Ttll9 UTSW 2 152999300 nonsense probably null
R7012:Ttll9 UTSW 2 153003062 missense possibly damaging 0.46
R7162:Ttll9 UTSW 2 152989603 missense probably damaging 0.99
R7862:Ttll9 UTSW 2 153006975 missense probably benign 0.00
R7945:Ttll9 UTSW 2 153006975 missense probably benign 0.00
R7998:Ttll9 UTSW 2 152991626 missense possibly damaging 0.55
R8041:Ttll9 UTSW 2 153003036 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- CCTCTTAGCAGAAGGTAGACGG -3'
(R):5'- AGCAGCCTCTTAGTGAATGTTG -3'

Sequencing Primer
(F):5'- TAGACGGGATCCCTGACAG -3'
(R):5'- ATGTTGTAAGCCAGGCACTC -3'
Posted On2019-11-26