Incidental Mutation 'R7804:Ago4'
ID600659
Institutional Source Beutler Lab
Gene Symbol Ago4
Ensembl Gene ENSMUSG00000042500
Gene Nameargonaute RISC catalytic subunit 4
Synonymsargonaute 4, Eif2c4, 5730550L01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.919) question?
Stock #R7804 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location126489541-126533472 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 126512630 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 296 (C296S)
Ref Sequence ENSEMBL: ENSMUSP00000081312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084289]
Predicted Effect probably benign
Transcript: ENSMUST00000084289
AA Change: C296S

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000081312
Gene: ENSMUSG00000042500
AA Change: C296S

DomainStartEndE-ValueType
Pfam:ArgoN 18 156 3.9e-28 PFAM
DUF1785 165 217 4.22e-24 SMART
PAZ 225 360 1.26e-3 SMART
Pfam:ArgoL2 365 412 1.2e-16 PFAM
Pfam:ArgoMid 421 503 8.6e-35 PFAM
Piwi 509 820 2.9e-130 SMART
Blast:Piwi 827 856 2e-9 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 95% (55/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Argonaute family of proteins which contain PAZ and PIWI domains and play an integral role in RNA interference and short-interfering-RNA-mediated gene silencing. This gene is located on chromosome 1 in a cluster of related family members. [provided by RefSeq, Mar 2017]
PHENOTYPE: Male mice homozygous for a null mutation display oligozoospermia, decreased testis weight, premature entry into meiosis and disruption of sex body formation. However both males and females are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933415A04Rik GTGTGTATGTGT GTGTGT 11: 43,587,414 probably benign Het
Apbb1 A G 7: 105,566,600 L401P probably damaging Het
Cacnb2 C A 2: 14,968,037 P252T probably benign Het
Ctnna2 C T 6: 77,641,374 V202I probably benign Het
Dapk1 A T 13: 60,725,339 I352F probably benign Het
Dexi T C 16: 10,542,485 D69G possibly damaging Het
Dgcr14 T A 16: 17,911,167 I47F probably damaging Het
Dlg5 T C 14: 24,165,320 E645G possibly damaging Het
Dnah3 A G 7: 119,952,618 I2826T probably damaging Het
Dnah3 A G 7: 120,011,012 W1734R probably damaging Het
Dtna A G 18: 23,595,609 K287R probably damaging Het
Elovl5 A G 9: 77,979,823 probably null Het
Fam222b C A 11: 78,154,153 P180Q probably benign Het
Fat3 C T 9: 15,990,592 V3046I probably benign Het
Fem1a A G 17: 56,258,068 D387G probably damaging Het
Frmd5 A G 2: 121,591,744 Y33H probably damaging Het
Gucy2g A T 19: 55,228,152 L464H probably benign Het
Ints2 T C 11: 86,212,663 E1189G possibly damaging Het
Itgb4 T C 11: 116,003,684 V1355A probably damaging Het
Lepr A T 4: 101,782,586 S750C probably damaging Het
Lingo1 T C 9: 56,619,514 D603G probably benign Het
Map4k3 A C 17: 80,615,070 V474G probably damaging Het
Myl4 T A 11: 104,584,961 V167E probably damaging Het
Naa25 T C 5: 121,424,589 V478A probably benign Het
Neurl4 T A 11: 69,905,874 L487H probably benign Het
Nkx2-9 C T 12: 56,612,132 R99H probably damaging Het
Olfr1215 C G 2: 89,001,511 R259P unknown Het
Olfr686 A T 7: 105,204,160 M61K probably damaging Het
Olfr809 A G 10: 129,776,222 I103V probably benign Het
Pcdhga9 A G 18: 37,738,079 I320M probably damaging Het
Pi15 T A 1: 17,624,913 C251* probably null Het
Pkhd1l1 A T 15: 44,597,138 K4248* probably null Het
Prkg1 C T 19: 30,578,632 V625I probably benign Het
Prkg1 G A 19: 30,624,770 A362V possibly damaging Het
Prol1 C T 5: 88,328,405 T218I unknown Het
Ptpro G A 6: 137,399,601 probably null Het
Rev3l T A 10: 39,823,485 I1326K probably benign Het
Shank1 C A 7: 44,312,884 R60S unknown Het
Slc24a2 A G 4: 86,991,537 V648A probably damaging Het
Slc35d3 T C 10: 19,849,370 T247A probably damaging Het
Specc1 C T 11: 62,205,397 T895I probably damaging Het
Spta1 A G 1: 174,195,905 E626G possibly damaging Het
Syngr2 C A 11: 117,812,575 S72R possibly damaging Het
Synj2 T A 17: 6,019,534 L490Q unknown Het
Tbc1d9 T C 8: 83,236,712 L351P possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Themis3 G A 17: 66,555,610 T451I probably benign Het
Tia1 T C 6: 86,424,382 S146P probably benign Het
Tpp2 T A 1: 43,983,281 N946K probably benign Het
Tpr A T 1: 150,432,559 R1688S probably damaging Het
Trav12-1 A G 14: 53,538,531 Q47R possibly damaging Het
Ttll9 G A 2: 153,002,358 probably null Het
Ttn G A 2: 76,707,241 T34781M possibly damaging Het
V1ra8 A G 6: 90,203,316 Y167C probably damaging Het
Vegfb T C 19: 6,986,339 D84G probably damaging Het
Vmn2r14 A T 5: 109,220,458 L223M probably benign Het
Wdr26 A G 1: 181,182,822 I554T probably damaging Het
Other mutations in Ago4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00957:Ago4 APN 4 126517133 missense probably benign 0.01
IGL00965:Ago4 APN 4 126493314 missense probably benign 0.01
IGL01306:Ago4 APN 4 126515884 splice site probably null
IGL01943:Ago4 APN 4 126517195 missense probably damaging 1.00
IGL02079:Ago4 APN 4 126517084 missense probably damaging 0.99
IGL02117:Ago4 APN 4 126516852 missense probably benign 0.00
IGL02229:Ago4 APN 4 126511532 missense probably benign 0.34
IGL02503:Ago4 APN 4 126496805 nonsense probably null
IGL02504:Ago4 APN 4 126517439 missense probably benign 0.00
IGL02975:Ago4 APN 4 126512519 critical splice donor site probably null
BB010:Ago4 UTSW 4 126507018 missense probably benign 0.22
BB020:Ago4 UTSW 4 126507018 missense probably benign 0.22
IGL02837:Ago4 UTSW 4 126497300 missense possibly damaging 0.73
R0129:Ago4 UTSW 4 126517183 missense possibly damaging 0.85
R0142:Ago4 UTSW 4 126516932 missense probably benign 0.24
R0480:Ago4 UTSW 4 126526077 missense probably benign 0.00
R0533:Ago4 UTSW 4 126516860 missense probably benign 0.00
R1014:Ago4 UTSW 4 126506785 missense probably damaging 1.00
R1350:Ago4 UTSW 4 126507132 missense probably benign 0.04
R1547:Ago4 UTSW 4 126511413 missense probably benign 0.01
R1894:Ago4 UTSW 4 126512600 missense probably benign 0.11
R1900:Ago4 UTSW 4 126516936 missense probably benign 0.00
R2510:Ago4 UTSW 4 126517071 missense probably damaging 1.00
R2511:Ago4 UTSW 4 126517071 missense probably damaging 1.00
R4063:Ago4 UTSW 4 126515862 intron probably benign
R4064:Ago4 UTSW 4 126515862 intron probably benign
R4120:Ago4 UTSW 4 126496807 missense probably damaging 1.00
R4916:Ago4 UTSW 4 126506842 missense probably damaging 1.00
R4917:Ago4 UTSW 4 126506842 missense probably damaging 1.00
R4918:Ago4 UTSW 4 126506842 missense probably damaging 1.00
R4941:Ago4 UTSW 4 126526054 missense probably benign 0.00
R5169:Ago4 UTSW 4 126511727 missense probably benign 0.06
R5262:Ago4 UTSW 4 126496764 missense possibly damaging 0.66
R5385:Ago4 UTSW 4 126517556 missense probably benign
R5757:Ago4 UTSW 4 126526084 missense probably damaging 1.00
R6244:Ago4 UTSW 4 126511487 missense possibly damaging 0.67
R6256:Ago4 UTSW 4 126520226 missense probably damaging 1.00
R6389:Ago4 UTSW 4 126507244 missense probably damaging 1.00
R6545:Ago4 UTSW 4 126512018 missense probably benign 0.10
R7378:Ago4 UTSW 4 126511464 missense probably benign
R7890:Ago4 UTSW 4 126526076 missense probably benign 0.00
R7933:Ago4 UTSW 4 126507018 missense probably benign 0.22
X0062:Ago4 UTSW 4 126515941 missense probably benign 0.00
X0064:Ago4 UTSW 4 126517482 missense possibly damaging 0.87
Z1176:Ago4 UTSW 4 126520190 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTTAGGTAAGAATGTCATTTGGCTC -3'
(R):5'- AATGAGCTATCTTGCTGCCTCC -3'

Sequencing Primer
(F):5'- GGTAAGAATGTCATTTGGCTCACCTC -3'
(R):5'- AACACATGGCTCTGTGCATG -3'
Posted On2019-11-26