Incidental Mutation 'R7804:Naa25'
ID600662
Institutional Source Beutler Lab
Gene Symbol Naa25
Ensembl Gene ENSMUSG00000042719
Gene NameN(alpha)-acetyltransferase 25, NatB auxiliary subunit
SynonymsC330023M02Rik, 4833422K13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7804 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location121397936-121444378 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121424589 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 478 (V478A)
Ref Sequence ENSEMBL: ENSMUSP00000038977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042163] [ENSMUST00000151458] [ENSMUST00000153758] [ENSMUST00000173895]
Predicted Effect probably benign
Transcript: ENSMUST00000042163
AA Change: V478A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000038977
Gene: ENSMUSG00000042719
AA Change: V478A

DomainStartEndE-ValueType
low complexity region 35 45 N/A INTRINSIC
Pfam:NatB_MDM20 263 658 1.6e-121 PFAM
low complexity region 672 683 N/A INTRINSIC
low complexity region 687 700 N/A INTRINSIC
low complexity region 721 734 N/A INTRINSIC
low complexity region 915 935 N/A INTRINSIC
low complexity region 958 971 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151458
SMART Domains Protein: ENSMUSP00000120970
Gene: ENSMUSG00000042719

DomainStartEndE-ValueType
SCOP:d1a17__ 21 94 1e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153758
SMART Domains Protein: ENSMUSP00000122522
Gene: ENSMUSG00000029616

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
SCOP:d1g7ea_ 35 55 3e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173895
Meta Mutation Damage Score 0.0767 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 95% (55/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the auxiliary subunit of the heteromeric N-terminal acetyltransferase B complex. This complex acetylates methionine residues that are followed by acidic or asparagine residues.[provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933415A04Rik GTGTGTATGTGT GTGTGT 11: 43,587,414 probably benign Het
Ago4 A T 4: 126,512,630 C296S probably benign Het
Apbb1 A G 7: 105,566,600 L401P probably damaging Het
Cacnb2 C A 2: 14,968,037 P252T probably benign Het
Ctnna2 C T 6: 77,641,374 V202I probably benign Het
Dapk1 A T 13: 60,725,339 I352F probably benign Het
Dexi T C 16: 10,542,485 D69G possibly damaging Het
Dgcr14 T A 16: 17,911,167 I47F probably damaging Het
Dlg5 T C 14: 24,165,320 E645G possibly damaging Het
Dnah3 A G 7: 119,952,618 I2826T probably damaging Het
Dnah3 A G 7: 120,011,012 W1734R probably damaging Het
Dtna A G 18: 23,595,609 K287R probably damaging Het
Elovl5 A G 9: 77,979,823 probably null Het
Fam222b C A 11: 78,154,153 P180Q probably benign Het
Fat3 C T 9: 15,990,592 V3046I probably benign Het
Fem1a A G 17: 56,258,068 D387G probably damaging Het
Frmd5 A G 2: 121,591,744 Y33H probably damaging Het
Gucy2g A T 19: 55,228,152 L464H probably benign Het
Ints2 T C 11: 86,212,663 E1189G possibly damaging Het
Itgb4 T C 11: 116,003,684 V1355A probably damaging Het
Lepr A T 4: 101,782,586 S750C probably damaging Het
Lingo1 T C 9: 56,619,514 D603G probably benign Het
Map4k3 A C 17: 80,615,070 V474G probably damaging Het
Myl4 T A 11: 104,584,961 V167E probably damaging Het
Neurl4 T A 11: 69,905,874 L487H probably benign Het
Nkx2-9 C T 12: 56,612,132 R99H probably damaging Het
Olfr1215 C G 2: 89,001,511 R259P unknown Het
Olfr686 A T 7: 105,204,160 M61K probably damaging Het
Olfr809 A G 10: 129,776,222 I103V probably benign Het
Pcdhga9 A G 18: 37,738,079 I320M probably damaging Het
Pi15 T A 1: 17,624,913 C251* probably null Het
Pkhd1l1 A T 15: 44,597,138 K4248* probably null Het
Prkg1 C T 19: 30,578,632 V625I probably benign Het
Prkg1 G A 19: 30,624,770 A362V possibly damaging Het
Prol1 C T 5: 88,328,405 T218I unknown Het
Ptpro G A 6: 137,399,601 probably null Het
Rev3l T A 10: 39,823,485 I1326K probably benign Het
Shank1 C A 7: 44,312,884 R60S unknown Het
Slc24a2 A G 4: 86,991,537 V648A probably damaging Het
Slc35d3 T C 10: 19,849,370 T247A probably damaging Het
Specc1 C T 11: 62,205,397 T895I probably damaging Het
Spta1 A G 1: 174,195,905 E626G possibly damaging Het
Syngr2 C A 11: 117,812,575 S72R possibly damaging Het
Synj2 T A 17: 6,019,534 L490Q unknown Het
Tbc1d9 T C 8: 83,236,712 L351P possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Themis3 G A 17: 66,555,610 T451I probably benign Het
Tia1 T C 6: 86,424,382 S146P probably benign Het
Tpp2 T A 1: 43,983,281 N946K probably benign Het
Tpr A T 1: 150,432,559 R1688S probably damaging Het
Trav12-1 A G 14: 53,538,531 Q47R possibly damaging Het
Ttll9 G A 2: 153,002,358 probably null Het
Ttn G A 2: 76,707,241 T34781M possibly damaging Het
V1ra8 A G 6: 90,203,316 Y167C probably damaging Het
Vegfb T C 19: 6,986,339 D84G probably damaging Het
Vmn2r14 A T 5: 109,220,458 L223M probably benign Het
Wdr26 A G 1: 181,182,822 I554T probably damaging Het
Other mutations in Naa25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02025:Naa25 APN 5 121439865 missense probably damaging 1.00
IGL02142:Naa25 APN 5 121426762 missense possibly damaging 0.52
IGL02541:Naa25 APN 5 121424531 missense possibly damaging 0.92
IGL02747:Naa25 APN 5 121414605 splice site probably benign
IGL03074:Naa25 APN 5 121408337 critical splice donor site probably null
IGL03119:Naa25 APN 5 121434978 missense probably null 1.00
IGL03218:Naa25 APN 5 121426070 missense probably damaging 1.00
R0003:Naa25 UTSW 5 121407184 intron probably benign
R0022:Naa25 UTSW 5 121417976 missense probably damaging 1.00
R0022:Naa25 UTSW 5 121417976 missense probably damaging 1.00
R0102:Naa25 UTSW 5 121435569 missense possibly damaging 0.69
R0102:Naa25 UTSW 5 121435569 missense possibly damaging 0.69
R0399:Naa25 UTSW 5 121435490 missense probably benign 0.00
R0973:Naa25 UTSW 5 121438716 splice site probably benign
R1418:Naa25 UTSW 5 121423734 missense probably damaging 1.00
R1582:Naa25 UTSW 5 121434829 missense probably benign
R1793:Naa25 UTSW 5 121417415 missense possibly damaging 0.82
R1793:Naa25 UTSW 5 121420593 missense probably damaging 1.00
R1863:Naa25 UTSW 5 121435548 missense probably benign 0.00
R3160:Naa25 UTSW 5 121435072 splice site probably null
R3162:Naa25 UTSW 5 121435072 splice site probably null
R3721:Naa25 UTSW 5 121431556 missense probably benign
R3864:Naa25 UTSW 5 121409197 missense probably damaging 0.96
R4852:Naa25 UTSW 5 121430692 missense probably damaging 1.00
R5077:Naa25 UTSW 5 121424576 missense probably benign 0.02
R5602:Naa25 UTSW 5 121420495 missense probably benign 0.30
R5855:Naa25 UTSW 5 121423692 missense possibly damaging 0.94
R6464:Naa25 UTSW 5 121417961 missense probably damaging 1.00
R6734:Naa25 UTSW 5 121438825 missense possibly damaging 0.65
R6750:Naa25 UTSW 5 121408309 missense probably damaging 1.00
R6767:Naa25 UTSW 5 121439865 missense probably damaging 1.00
R6856:Naa25 UTSW 5 121438804 missense probably damaging 1.00
R7145:Naa25 UTSW 5 121417489 critical splice donor site probably null
R7631:Naa25 UTSW 5 121438728 missense possibly damaging 0.92
R7701:Naa25 UTSW 5 121425979 missense probably benign
R7800:Naa25 UTSW 5 121424531 missense possibly damaging 0.92
R7822:Naa25 UTSW 5 121407213 missense probably damaging 1.00
R8707:Naa25 UTSW 5 121414812 missense not run
X0004:Naa25 UTSW 5 121413081 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATCCCAGGTTATTATTAAGGC -3'
(R):5'- GCTGATTGGGTCACACTCATC -3'

Sequencing Primer
(F):5'- AGGCTTATATTTGTCTTCAGTACTCC -3'
(R):5'- CTGATTGGGTCACACTCATCAGAAG -3'
Posted On2019-11-26