Incidental Mutation 'R7804:Ctnna2'
ID600663
Institutional Source Beutler Lab
Gene Symbol Ctnna2
Ensembl Gene ENSMUSG00000063063
Gene Namecatenin (cadherin associated protein), alpha 2
Synonymschp, Catna, alpha N-catenin, alpha(N)-catenin, Catna2
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.915) question?
Stock #R7804 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location76881637-77979699 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 77641374 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 202 (V202I)
Ref Sequence ENSEMBL: ENSMUSP00000124764 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075340] [ENSMUST00000159626] [ENSMUST00000160894] [ENSMUST00000161846] [ENSMUST00000162273]
Predicted Effect probably benign
Transcript: ENSMUST00000075340
AA Change: V189I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000074809
Gene: ENSMUSG00000063063
AA Change: V189I

DomainStartEndE-ValueType
Pfam:Vinculin 18 337 2e-104 PFAM
Pfam:Vinculin 331 866 7.7e-222 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159626
AA Change: V189I

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000124376
Gene: ENSMUSG00000063063
AA Change: V189I

DomainStartEndE-ValueType
Pfam:Vinculin 18 337 3.4e-105 PFAM
Pfam:Vinculin 330 914 6.6e-214 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160894
AA Change: V202I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000124764
Gene: ENSMUSG00000063063
AA Change: V202I

DomainStartEndE-ValueType
Pfam:Vinculin 31 352 2.1e-104 PFAM
Pfam:Vinculin 343 927 4.6e-213 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161846
AA Change: V202I

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000123714
Gene: ENSMUSG00000063063
AA Change: V202I

DomainStartEndE-ValueType
Pfam:Vinculin 31 350 5.3e-105 PFAM
Pfam:Vinculin 344 879 2.1e-222 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162273
AA Change: V189I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000124689
Gene: ENSMUSG00000063063
AA Change: V189I

DomainStartEndE-ValueType
Pfam:Vinculin 18 356 1.8e-106 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Animals homozygous for a mutation of this gene exhibit ataxia, reduced body weight, reduced male fertility, and abnormalities of the brain which include a hypoplastic cerebellum, abnormal foliation pattern, ectopic Purkinje cells, and abnormal pyramidal cells in the hippocampus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933415A04Rik GTGTGTATGTGT GTGTGT 11: 43,587,414 probably benign Het
Ago4 A T 4: 126,512,630 C296S probably benign Het
Apbb1 A G 7: 105,566,600 L401P probably damaging Het
Cacnb2 C A 2: 14,968,037 P252T probably benign Het
Dapk1 A T 13: 60,725,339 I352F probably benign Het
Dexi T C 16: 10,542,485 D69G possibly damaging Het
Dgcr14 T A 16: 17,911,167 I47F probably damaging Het
Dlg5 T C 14: 24,165,320 E645G possibly damaging Het
Dnah3 A G 7: 119,952,618 I2826T probably damaging Het
Dnah3 A G 7: 120,011,012 W1734R probably damaging Het
Dtna A G 18: 23,595,609 K287R probably damaging Het
Elovl5 A G 9: 77,979,823 probably null Het
Fam222b C A 11: 78,154,153 P180Q probably benign Het
Fat3 C T 9: 15,990,592 V3046I probably benign Het
Fem1a A G 17: 56,258,068 D387G probably damaging Het
Frmd5 A G 2: 121,591,744 Y33H probably damaging Het
Gucy2g A T 19: 55,228,152 L464H probably benign Het
Ints2 T C 11: 86,212,663 E1189G possibly damaging Het
Itgb4 T C 11: 116,003,684 V1355A probably damaging Het
Lepr A T 4: 101,782,586 S750C probably damaging Het
Lingo1 T C 9: 56,619,514 D603G probably benign Het
Map4k3 A C 17: 80,615,070 V474G probably damaging Het
Myl4 T A 11: 104,584,961 V167E probably damaging Het
Naa25 T C 5: 121,424,589 V478A probably benign Het
Neurl4 T A 11: 69,905,874 L487H probably benign Het
Nkx2-9 C T 12: 56,612,132 R99H probably damaging Het
Olfr1215 C G 2: 89,001,511 R259P unknown Het
Olfr686 A T 7: 105,204,160 M61K probably damaging Het
Olfr809 A G 10: 129,776,222 I103V probably benign Het
Pcdhga9 A G 18: 37,738,079 I320M probably damaging Het
Pi15 T A 1: 17,624,913 C251* probably null Het
Pkhd1l1 A T 15: 44,597,138 K4248* probably null Het
Prkg1 C T 19: 30,578,632 V625I probably benign Het
Prkg1 G A 19: 30,624,770 A362V possibly damaging Het
Prol1 C T 5: 88,328,405 T218I unknown Het
Rev3l T A 10: 39,823,485 I1326K probably benign Het
Shank1 C A 7: 44,312,884 R60S unknown Het
Slc24a2 A G 4: 86,991,537 V648A probably damaging Het
Slc35d3 T C 10: 19,849,370 T247A probably damaging Het
Specc1 C T 11: 62,205,397 T895I probably damaging Het
Spta1 A G 1: 174,195,905 E626G possibly damaging Het
Syngr2 C A 11: 117,812,575 S72R possibly damaging Het
Synj2 T A 17: 6,019,534 L490Q unknown Het
Tbc1d9 T C 8: 83,236,712 L351P possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Themis3 G A 17: 66,555,610 T451I probably benign Het
Tia1 T C 6: 86,424,382 S146P probably benign Het
Tpp2 T A 1: 43,983,281 N946K probably benign Het
Tpr A T 1: 150,432,559 R1688S probably damaging Het
Trav12-1 A G 14: 53,538,531 Q47R possibly damaging Het
Ttll9 G A 2: 153,002,358 probably null Het
Ttn G A 2: 76,707,241 T34781M possibly damaging Het
V1ra8 A G 6: 90,203,316 Y167C probably damaging Het
Vegfb T C 19: 6,986,339 D84G probably damaging Het
Vmn2r14 A T 5: 109,220,458 L223M probably benign Het
Wdr26 A G 1: 181,182,822 I554T probably damaging Het
Other mutations in Ctnna2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Ctnna2 APN 6 76980761 missense probably damaging 1.00
IGL00573:Ctnna2 APN 6 76902281 intron probably benign
IGL01290:Ctnna2 APN 6 76882560 missense possibly damaging 0.89
IGL01719:Ctnna2 APN 6 77636975 nonsense probably null
IGL01725:Ctnna2 APN 6 77641365 missense possibly damaging 0.89
IGL02381:Ctnna2 APN 6 76954783 missense probably benign 0.27
IGL02561:Ctnna2 APN 6 77845580 missense probably benign 0.34
IGL02653:Ctnna2 APN 6 76980777 missense probably benign 0.00
IGL02658:Ctnna2 APN 6 76980824 missense probably benign 0.00
IGL02721:Ctnna2 APN 6 76981869 missense probably damaging 0.99
IGL03075:Ctnna2 APN 6 76954730 missense probably benign 0.14
IGL03291:Ctnna2 APN 6 76973712 missense probably damaging 1.00
R0379:Ctnna2 UTSW 6 77641440 missense probably benign 0.01
R0423:Ctnna2 UTSW 6 77653069 missense probably damaging 1.00
R0539:Ctnna2 UTSW 6 76973899 missense probably damaging 1.00
R0540:Ctnna2 UTSW 6 76902430 missense probably benign 0.00
R0545:Ctnna2 UTSW 6 77605182 missense probably damaging 1.00
R0559:Ctnna2 UTSW 6 76915850 missense probably damaging 1.00
R0582:Ctnna2 UTSW 6 77758417 missense probably benign 0.07
R0607:Ctnna2 UTSW 6 76902430 missense probably benign 0.00
R1318:Ctnna2 UTSW 6 76882790 missense probably damaging 1.00
R1754:Ctnna2 UTSW 6 77636749 missense possibly damaging 0.61
R1838:Ctnna2 UTSW 6 77845542 missense probably damaging 0.99
R1924:Ctnna2 UTSW 6 76954847 missense possibly damaging 0.75
R1969:Ctnna2 UTSW 6 77758500 missense probably damaging 0.99
R2011:Ctnna2 UTSW 6 76973791 missense possibly damaging 0.47
R2867:Ctnna2 UTSW 6 77114922 splice site probably benign
R3103:Ctnna2 UTSW 6 77653144 missense possibly damaging 0.66
R3772:Ctnna2 UTSW 6 76973769 missense probably damaging 0.99
R3809:Ctnna2 UTSW 6 76954757 missense probably damaging 0.99
R4023:Ctnna2 UTSW 6 77636844 missense possibly damaging 0.90
R4024:Ctnna2 UTSW 6 77636844 missense possibly damaging 0.90
R4025:Ctnna2 UTSW 6 77636844 missense possibly damaging 0.90
R4026:Ctnna2 UTSW 6 77636844 missense possibly damaging 0.90
R4288:Ctnna2 UTSW 6 77605221 missense probably damaging 0.96
R4291:Ctnna2 UTSW 6 76882745 missense probably damaging 1.00
R4493:Ctnna2 UTSW 6 76981848 missense probably damaging 0.99
R4561:Ctnna2 UTSW 6 77636713 critical splice donor site probably null
R4824:Ctnna2 UTSW 6 76980781 missense probably damaging 1.00
R4960:Ctnna2 UTSW 6 77653111 missense probably damaging 1.00
R4999:Ctnna2 UTSW 6 76915762 missense possibly damaging 0.86
R5041:Ctnna2 UTSW 6 76915763 missense probably damaging 1.00
R5093:Ctnna2 UTSW 6 77114929 critical splice donor site probably null
R5411:Ctnna2 UTSW 6 77114931 missense probably damaging 1.00
R5847:Ctnna2 UTSW 6 76973837 missense possibly damaging 0.87
R5874:Ctnna2 UTSW 6 76902430 missense probably benign 0.00
R5935:Ctnna2 UTSW 6 77143921 missense probably benign 0.01
R6008:Ctnna2 UTSW 6 76915828 missense probably damaging 1.00
R6115:Ctnna2 UTSW 6 77636839 missense probably benign 0.10
R6369:Ctnna2 UTSW 6 76980695 missense possibly damaging 0.88
R6490:Ctnna2 UTSW 6 77143909 missense probably benign
R7021:Ctnna2 UTSW 6 77636905 missense probably damaging 1.00
R7152:Ctnna2 UTSW 6 76980824 missense possibly damaging 0.48
R7662:Ctnna2 UTSW 6 77636869 missense probably damaging 1.00
Z1177:Ctnna2 UTSW 6 76973781 missense possibly damaging 0.94
Z1177:Ctnna2 UTSW 6 76980740 missense probably damaging 1.00
Z1177:Ctnna2 UTSW 6 77641417 missense probably benign 0.01
Z1177:Ctnna2 UTSW 6 77758554 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- CAGTGAAAAGTGGTGCTCTGTG -3'
(R):5'- AAGATACCATTGGTAGCATGCTC -3'

Sequencing Primer
(F):5'- GCTCTGTGATCTATAGGCAGCAAC -3'
(R):5'- TCTATTTCAGGTCGAGGAG -3'
Posted On2019-11-26