Incidental Mutation 'R7804:Olfr686'
ID600667
Institutional Source Beutler Lab
Gene Symbol Olfr686
Ensembl Gene ENSMUSG00000048425
Gene Nameolfactory receptor 686
SynonymsGA_x6K02T2PBJ9-7832633-7831680, MOR35-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R7804 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location105201858-105207485 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 105204160 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 61 (M61K)
Ref Sequence ENSEMBL: ENSMUSP00000148898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050157] [ENSMUST00000214147] [ENSMUST00000216143] [ENSMUST00000216613]
Predicted Effect probably damaging
Transcript: ENSMUST00000050157
AA Change: M61K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000049601
Gene: ENSMUSG00000048425
AA Change: M61K

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 8e-92 PFAM
Pfam:7TM_GPCR_Srsx 37 229 3e-9 PFAM
Pfam:7tm_1 43 294 9e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214147
AA Change: M61K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000216143
AA Change: M61K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000216613
AA Change: M61K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 95% (55/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933415A04Rik GTGTGTATGTGT GTGTGT 11: 43,587,414 probably benign Het
Ago4 A T 4: 126,512,630 C296S probably benign Het
Apbb1 A G 7: 105,566,600 L401P probably damaging Het
Cacnb2 C A 2: 14,968,037 P252T probably benign Het
Ctnna2 C T 6: 77,641,374 V202I probably benign Het
Dapk1 A T 13: 60,725,339 I352F probably benign Het
Dexi T C 16: 10,542,485 D69G possibly damaging Het
Dgcr14 T A 16: 17,911,167 I47F probably damaging Het
Dlg5 T C 14: 24,165,320 E645G possibly damaging Het
Dnah3 A G 7: 119,952,618 I2826T probably damaging Het
Dnah3 A G 7: 120,011,012 W1734R probably damaging Het
Dtna A G 18: 23,595,609 K287R probably damaging Het
Elovl5 A G 9: 77,979,823 probably null Het
Fam222b C A 11: 78,154,153 P180Q probably benign Het
Fat3 C T 9: 15,990,592 V3046I probably benign Het
Fem1a A G 17: 56,258,068 D387G probably damaging Het
Frmd5 A G 2: 121,591,744 Y33H probably damaging Het
Gucy2g A T 19: 55,228,152 L464H probably benign Het
Ints2 T C 11: 86,212,663 E1189G possibly damaging Het
Itgb4 T C 11: 116,003,684 V1355A probably damaging Het
Lepr A T 4: 101,782,586 S750C probably damaging Het
Lingo1 T C 9: 56,619,514 D603G probably benign Het
Map4k3 A C 17: 80,615,070 V474G probably damaging Het
Myl4 T A 11: 104,584,961 V167E probably damaging Het
Naa25 T C 5: 121,424,589 V478A probably benign Het
Neurl4 T A 11: 69,905,874 L487H probably benign Het
Nkx2-9 C T 12: 56,612,132 R99H probably damaging Het
Olfr1215 C G 2: 89,001,511 R259P unknown Het
Olfr809 A G 10: 129,776,222 I103V probably benign Het
Pcdhga9 A G 18: 37,738,079 I320M probably damaging Het
Pi15 T A 1: 17,624,913 C251* probably null Het
Pkhd1l1 A T 15: 44,597,138 K4248* probably null Het
Prkg1 C T 19: 30,578,632 V625I probably benign Het
Prkg1 G A 19: 30,624,770 A362V possibly damaging Het
Prol1 C T 5: 88,328,405 T218I unknown Het
Ptpro G A 6: 137,399,601 probably null Het
Rev3l T A 10: 39,823,485 I1326K probably benign Het
Shank1 C A 7: 44,312,884 R60S unknown Het
Slc24a2 A G 4: 86,991,537 V648A probably damaging Het
Slc35d3 T C 10: 19,849,370 T247A probably damaging Het
Specc1 C T 11: 62,205,397 T895I probably damaging Het
Spta1 A G 1: 174,195,905 E626G possibly damaging Het
Syngr2 C A 11: 117,812,575 S72R possibly damaging Het
Synj2 T A 17: 6,019,534 L490Q unknown Het
Tbc1d9 T C 8: 83,236,712 L351P possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Themis3 G A 17: 66,555,610 T451I probably benign Het
Tia1 T C 6: 86,424,382 S146P probably benign Het
Tpp2 T A 1: 43,983,281 N946K probably benign Het
Tpr A T 1: 150,432,559 R1688S probably damaging Het
Trav12-1 A G 14: 53,538,531 Q47R possibly damaging Het
Ttll9 G A 2: 153,002,358 probably null Het
Ttn G A 2: 76,707,241 T34781M possibly damaging Het
V1ra8 A G 6: 90,203,316 Y167C probably damaging Het
Vegfb T C 19: 6,986,339 D84G probably damaging Het
Vmn2r14 A T 5: 109,220,458 L223M probably benign Het
Wdr26 A G 1: 181,182,822 I554T probably damaging Het
Other mutations in Olfr686
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01580:Olfr686 APN 7 105203906 missense probably benign 0.01
R0112:Olfr686 UTSW 7 105203659 missense probably benign 0.05
R0234:Olfr686 UTSW 7 105203614 missense probably damaging 1.00
R0234:Olfr686 UTSW 7 105203614 missense probably damaging 1.00
R0541:Olfr686 UTSW 7 105204160 missense probably damaging 0.99
R0771:Olfr686 UTSW 7 105204161 missense possibly damaging 0.91
R3944:Olfr686 UTSW 7 105203955 nonsense probably null
R4079:Olfr686 UTSW 7 105204021 missense probably damaging 1.00
R4929:Olfr686 UTSW 7 105204025 missense probably damaging 1.00
R4978:Olfr686 UTSW 7 105204191 missense probably benign 0.02
R6267:Olfr686 UTSW 7 105203392 missense probably damaging 1.00
R6302:Olfr686 UTSW 7 105203719 missense probably damaging 1.00
R6483:Olfr686 UTSW 7 105204293 missense probably benign
R7787:Olfr686 UTSW 7 105204045 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGATAGCCACAAATCGGTCC -3'
(R):5'- TGTGTGGGAGAGCAACTATG -3'

Sequencing Primer
(F):5'- AATCGGTCCAAGGCCATG -3'
(R):5'- GCTGCCCATGTTTGGATA -3'
Posted On2019-11-26