Mutagenetix > Incidental Mutations

Incidental Mutation 'R7804:Elovl5'

600674

Institutional Source

Beutler Lab

Gene Symbol

Elovl5

Ensembl Gene

ENSMUSG00000032349

Gene Name

ELOVL family member 5, elongation of long chain fatty acids (yeast)

Synonyms

1110059L23Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7804 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

77917364-77984519 bp(+) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

A to G at 77979823 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000034904 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034904] [ENSMUST00000133757]

Predicted Effect

probably null
Transcript: ENSMUST00000034904

SMART Domains

Protein: ENSMUSP00000034904
Gene: ENSMUSG00000032349

Domain	Start	End	E-Value	Type
Pfam:ELO	27	262	2.3e-68	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000133757

SMART Domains

Protein: ENSMUSP00000123121
Gene: ENSMUSG00000032349

Domain	Start	End	E-Value	Type
Pfam:ELO	27	180	4.6e-46	PFAM

Meta Mutation Damage Score

0.9502

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

95% (55/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ELO family. It is highly expressed in the adrenal gland and testis, and encodes a multi-pass membrane protein that is localized in the endoplasmic reticulum. This protein is involved in the elongation of long-chain polyunsaturated fatty acids. Mutations in this gene have been associated with spinocerebellar ataxia-38 (SCA38). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a gene trapped allele have defects in fatty acid synthesis in the liver that result in hepatic steatosis. Also, majority of female mice have defects in female fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933415A04Rik	GTGTGTATGTGT	GTGTGT	11: 43,587,414		probably benign	Het
Ago4	A	T	4: 126,512,630	C296S	probably benign	Het
Apbb1	A	G	7: 105,566,600	L401P	probably damaging	Het
Cacnb2	C	A	2: 14,968,037	P252T	probably benign	Het
Ctnna2	C	T	6: 77,641,374	V202I	probably benign	Het
Dapk1	A	T	13: 60,725,339	I352F	probably benign	Het
Dexi	T	C	16: 10,542,485	D69G	possibly damaging	Het
Dgcr14	T	A	16: 17,911,167	I47F	probably damaging	Het
Dlg5	T	C	14: 24,165,320	E645G	possibly damaging	Het
Dnah3	A	G	7: 119,952,618	I2826T	probably damaging	Het
Dnah3	A	G	7: 120,011,012	W1734R	probably damaging	Het
Dtna	A	G	18: 23,595,609	K287R	probably damaging	Het
Fam222b	C	A	11: 78,154,153	P180Q	probably benign	Het
Fat3	C	T	9: 15,990,592	V3046I	probably benign	Het
Fem1a	A	G	17: 56,258,068	D387G	probably damaging	Het
Frmd5	A	G	2: 121,591,744	Y33H	probably damaging	Het
Gucy2g	A	T	19: 55,228,152	L464H	probably benign	Het
Ints2	T	C	11: 86,212,663	E1189G	possibly damaging	Het
Itgb4	T	C	11: 116,003,684	V1355A	probably damaging	Het
Lepr	A	T	4: 101,782,586	S750C	probably damaging	Het
Lingo1	T	C	9: 56,619,514	D603G	probably benign	Het
Map4k3	A	C	17: 80,615,070	V474G	probably damaging	Het
Myl4	T	A	11: 104,584,961	V167E	probably damaging	Het
Naa25	T	C	5: 121,424,589	V478A	probably benign	Het
Neurl4	T	A	11: 69,905,874	L487H	probably benign	Het
Nkx2-9	C	T	12: 56,612,132	R99H	probably damaging	Het
Olfr1215	C	G	2: 89,001,511	R259P	unknown	Het
Olfr686	A	T	7: 105,204,160	M61K	probably damaging	Het
Olfr809	A	G	10: 129,776,222	I103V	probably benign	Het
Pcdhga9	A	G	18: 37,738,079	I320M	probably damaging	Het
Pi15	T	A	1: 17,624,913	C251*	probably null	Het
Pkhd1l1	A	T	15: 44,597,138	K4248*	probably null	Het
Prkg1	C	T	19: 30,578,632	V625I	probably benign	Het
Prkg1	G	A	19: 30,624,770	A362V	possibly damaging	Het
Prol1	C	T	5: 88,328,405	T218I	unknown	Het
Ptpro	G	A	6: 137,399,601		probably null	Het
Rev3l	T	A	10: 39,823,485	I1326K	probably benign	Het
Shank1	C	A	7: 44,312,884	R60S	unknown	Het
Slc24a2	A	G	4: 86,991,537	V648A	probably damaging	Het
Slc35d3	T	C	10: 19,849,370	T247A	probably damaging	Het
Specc1	C	T	11: 62,205,397	T895I	probably damaging	Het
Spta1	A	G	1: 174,195,905	E626G	possibly damaging	Het
Syngr2	C	A	11: 117,812,575	S72R	possibly damaging	Het
Synj2	T	A	17: 6,019,534	L490Q	unknown	Het
Tbc1d9	T	C	8: 83,236,712	L351P	possibly damaging	Het
Tcof1	G	C	18: 60,829,051	A702G	possibly damaging	Het
Themis3	G	A	17: 66,555,610	T451I	probably benign	Het
Tia1	T	C	6: 86,424,382	S146P	probably benign	Het
Tpp2	T	A	1: 43,983,281	N946K	probably benign	Het
Tpr	A	T	1: 150,432,559	R1688S	probably damaging	Het
Trav12-1	A	G	14: 53,538,531	Q47R	possibly damaging	Het
Ttll9	G	A	2: 153,002,358		probably null	Het
Ttn	G	A	2: 76,707,241	T34781M	possibly damaging	Het
V1ra8	A	G	6: 90,203,316	Y167C	probably damaging	Het
Vegfb	T	C	19: 6,986,339	D84G	probably damaging	Het
Vmn2r14	A	T	5: 109,220,458	L223M	probably benign	Het
Wdr26	A	G	1: 181,182,822	I554T	probably damaging	Het

Other mutations in Elovl5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00561:Elovl5	APN	9	77960974	missense	probably benign	0.12
IGL01017:Elovl5	APN	9	77981571	missense	possibly damaging	0.67
IGL02331:Elovl5	APN	9	77979899	missense	possibly damaging	0.81
IGL02851:Elovl5	APN	9	77981502	missense	probably damaging	1.00
IGL03011:Elovl5	APN	9	77982784	missense	probably benign	0.32
euge	UTSW	9	77979823	critical splice acceptor site	probably null
laid-up	UTSW	9	77981502	missense	probably damaging	0.99
R0452:Elovl5	UTSW	9	77960911	missense	probably damaging	1.00
R0494:Elovl5	UTSW	9	77960917	missense	probably benign	0.05
R3706:Elovl5	UTSW	9	77979837	missense	probably null	1.00
R4353:Elovl5	UTSW	9	77960917	missense	probably benign	0.05
R6211:Elovl5	UTSW	9	77981502	missense	probably damaging	0.99
R6640:Elovl5	UTSW	9	77979913	nonsense	probably null
R8179:Elovl5	UTSW	9	77976899	missense	probably damaging	1.00
RF031:Elovl5	UTSW	9	77981473	critical splice acceptor site	probably null
Z1176:Elovl5	UTSW	9	77976755	missense	possibly damaging	0.48

Predicted Primers

PCR Primer
(F):5'- CATATGGCAGGTCTGTGGAC -3'
(R):5'- ATCTGGCAGGGAACAAGTTCTG -3'

Sequencing Primer
(F):5'- AAGGTGTCCTATGGCTGCC -3'
(R):5'- CAAGTTCTGGGCACAGGGAC -3'

Posted On

2019-11-26