Incidental Mutation 'R7804:Elovl5'
ID600674
Institutional Source Beutler Lab
Gene Symbol Elovl5
Ensembl Gene ENSMUSG00000032349
Gene NameELOVL family member 5, elongation of long chain fatty acids (yeast)
Synonyms1110059L23Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7804 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location77917364-77984519 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to G at 77979823 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034904] [ENSMUST00000133757]
Predicted Effect probably null
Transcript: ENSMUST00000034904
SMART Domains Protein: ENSMUSP00000034904
Gene: ENSMUSG00000032349

DomainStartEndE-ValueType
Pfam:ELO 27 262 2.3e-68 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000133757
SMART Domains Protein: ENSMUSP00000123121
Gene: ENSMUSG00000032349

DomainStartEndE-ValueType
Pfam:ELO 27 180 4.6e-46 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 95% (55/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ELO family. It is highly expressed in the adrenal gland and testis, and encodes a multi-pass membrane protein that is localized in the endoplasmic reticulum. This protein is involved in the elongation of long-chain polyunsaturated fatty acids. Mutations in this gene have been associated with spinocerebellar ataxia-38 (SCA38). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a gene trapped allele have defects in fatty acid synthesis in the liver that result in hepatic steatosis. Also, majority of female mice have defects in female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933415A04Rik GTGTGTATGTGT GTGTGT 11: 43,587,414 probably benign Het
Ago4 A T 4: 126,512,630 C296S probably benign Het
Apbb1 A G 7: 105,566,600 L401P probably damaging Het
Cacnb2 C A 2: 14,968,037 P252T probably benign Het
Ctnna2 C T 6: 77,641,374 V202I probably benign Het
Dapk1 A T 13: 60,725,339 I352F probably benign Het
Dexi T C 16: 10,542,485 D69G possibly damaging Het
Dgcr14 T A 16: 17,911,167 I47F probably damaging Het
Dlg5 T C 14: 24,165,320 E645G possibly damaging Het
Dnah3 A G 7: 119,952,618 I2826T probably damaging Het
Dnah3 A G 7: 120,011,012 W1734R probably damaging Het
Dtna A G 18: 23,595,609 K287R probably damaging Het
Fam222b C A 11: 78,154,153 P180Q probably benign Het
Fat3 C T 9: 15,990,592 V3046I probably benign Het
Fem1a A G 17: 56,258,068 D387G probably damaging Het
Frmd5 A G 2: 121,591,744 Y33H probably damaging Het
Gucy2g A T 19: 55,228,152 L464H probably benign Het
Ints2 T C 11: 86,212,663 E1189G possibly damaging Het
Itgb4 T C 11: 116,003,684 V1355A probably damaging Het
Lepr A T 4: 101,782,586 S750C probably damaging Het
Lingo1 T C 9: 56,619,514 D603G probably benign Het
Map4k3 A C 17: 80,615,070 V474G probably damaging Het
Myl4 T A 11: 104,584,961 V167E probably damaging Het
Naa25 T C 5: 121,424,589 V478A probably benign Het
Neurl4 T A 11: 69,905,874 L487H probably benign Het
Nkx2-9 C T 12: 56,612,132 R99H probably damaging Het
Olfr1215 C G 2: 89,001,511 R259P unknown Het
Olfr686 A T 7: 105,204,160 M61K probably damaging Het
Olfr809 A G 10: 129,776,222 I103V probably benign Het
Pcdhga9 A G 18: 37,738,079 I320M probably damaging Het
Pi15 T A 1: 17,624,913 C251* probably null Het
Pkhd1l1 A T 15: 44,597,138 K4248* probably null Het
Prkg1 C T 19: 30,578,632 V625I probably benign Het
Prkg1 G A 19: 30,624,770 A362V possibly damaging Het
Prol1 C T 5: 88,328,405 T218I unknown Het
Ptpro G A 6: 137,399,601 probably null Het
Rev3l T A 10: 39,823,485 I1326K probably benign Het
Shank1 C A 7: 44,312,884 R60S unknown Het
Slc24a2 A G 4: 86,991,537 V648A probably damaging Het
Slc35d3 T C 10: 19,849,370 T247A probably damaging Het
Specc1 C T 11: 62,205,397 T895I probably damaging Het
Spta1 A G 1: 174,195,905 E626G possibly damaging Het
Syngr2 C A 11: 117,812,575 S72R possibly damaging Het
Synj2 T A 17: 6,019,534 L490Q unknown Het
Tbc1d9 T C 8: 83,236,712 L351P possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Themis3 G A 17: 66,555,610 T451I probably benign Het
Tia1 T C 6: 86,424,382 S146P probably benign Het
Tpp2 T A 1: 43,983,281 N946K probably benign Het
Tpr A T 1: 150,432,559 R1688S probably damaging Het
Trav12-1 A G 14: 53,538,531 Q47R possibly damaging Het
Ttll9 G A 2: 153,002,358 probably null Het
Ttn G A 2: 76,707,241 T34781M possibly damaging Het
V1ra8 A G 6: 90,203,316 Y167C probably damaging Het
Vegfb T C 19: 6,986,339 D84G probably damaging Het
Vmn2r14 A T 5: 109,220,458 L223M probably benign Het
Wdr26 A G 1: 181,182,822 I554T probably damaging Het
Other mutations in Elovl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Elovl5 APN 9 77960974 missense probably benign 0.12
IGL01017:Elovl5 APN 9 77981571 missense possibly damaging 0.67
IGL02331:Elovl5 APN 9 77979899 missense possibly damaging 0.81
IGL02851:Elovl5 APN 9 77981502 missense probably damaging 1.00
IGL03011:Elovl5 APN 9 77982784 missense probably benign 0.32
laid-up UTSW 9 77981502 missense probably damaging 0.99
R0452:Elovl5 UTSW 9 77960911 missense probably damaging 1.00
R0494:Elovl5 UTSW 9 77960917 missense probably benign 0.05
R3706:Elovl5 UTSW 9 77979837 missense probably null 1.00
R4353:Elovl5 UTSW 9 77960917 missense probably benign 0.05
R6211:Elovl5 UTSW 9 77981502 missense probably damaging 0.99
R6640:Elovl5 UTSW 9 77979913 nonsense probably null
RF031:Elovl5 UTSW 9 77981473 critical splice acceptor site probably null
Z1176:Elovl5 UTSW 9 77976755 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- CATATGGCAGGTCTGTGGAC -3'
(R):5'- ATCTGGCAGGGAACAAGTTCTG -3'

Sequencing Primer
(F):5'- AAGGTGTCCTATGGCTGCC -3'
(R):5'- CAAGTTCTGGGCACAGGGAC -3'
Posted On2019-11-26