Incidental Mutation 'R7804:Slc35d3'
ID600675
Institutional Source Beutler Lab
Gene Symbol Slc35d3
Ensembl Gene ENSMUSG00000050473
Gene Namesolute carrier family 35, member D3
Synonyms6230421J19Rik, Frcl1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.235) question?
Stock #R7804 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location19847916-19851459 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19849370 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 247 (T247A)
Ref Sequence ENSEMBL: ENSMUSP00000060589 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020182] [ENSMUST00000059805]
Predicted Effect probably benign
Transcript: ENSMUST00000020182
SMART Domains Protein: ENSMUSP00000020182
Gene: ENSMUSG00000020003

DomainStartEndE-ValueType
WD40 52 91 9.24e-4 SMART
WD40 95 136 6.14e-9 SMART
WD40 139 179 8.55e-8 SMART
WD40 182 222 3.5e-4 SMART
WD40 226 266 1.3e-7 SMART
WD40 270 310 6.66e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000059805
AA Change: T247A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060589
Gene: ENSMUSG00000050473
AA Change: T247A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 47 64 N/A INTRINSIC
low complexity region 84 96 N/A INTRINSIC
transmembrane domain 101 123 N/A INTRINSIC
transmembrane domain 130 152 N/A INTRINSIC
transmembrane domain 156 175 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
transmembrane domain 224 246 N/A INTRINSIC
transmembrane domain 253 275 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit decreased platelet serotonin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933415A04Rik GTGTGTATGTGT GTGTGT 11: 43,587,414 probably benign Het
Ago4 A T 4: 126,512,630 C296S probably benign Het
Apbb1 A G 7: 105,566,600 L401P probably damaging Het
Cacnb2 C A 2: 14,968,037 P252T probably benign Het
Ctnna2 C T 6: 77,641,374 V202I probably benign Het
Dapk1 A T 13: 60,725,339 I352F probably benign Het
Dexi T C 16: 10,542,485 D69G possibly damaging Het
Dgcr14 T A 16: 17,911,167 I47F probably damaging Het
Dlg5 T C 14: 24,165,320 E645G possibly damaging Het
Dnah3 A G 7: 119,952,618 I2826T probably damaging Het
Dnah3 A G 7: 120,011,012 W1734R probably damaging Het
Dtna A G 18: 23,595,609 K287R probably damaging Het
Elovl5 A G 9: 77,979,823 probably null Het
Fam222b C A 11: 78,154,153 P180Q probably benign Het
Fat3 C T 9: 15,990,592 V3046I probably benign Het
Fem1a A G 17: 56,258,068 D387G probably damaging Het
Frmd5 A G 2: 121,591,744 Y33H probably damaging Het
Gucy2g A T 19: 55,228,152 L464H probably benign Het
Ints2 T C 11: 86,212,663 E1189G possibly damaging Het
Itgb4 T C 11: 116,003,684 V1355A probably damaging Het
Lepr A T 4: 101,782,586 S750C probably damaging Het
Lingo1 T C 9: 56,619,514 D603G probably benign Het
Map4k3 A C 17: 80,615,070 V474G probably damaging Het
Myl4 T A 11: 104,584,961 V167E probably damaging Het
Naa25 T C 5: 121,424,589 V478A probably benign Het
Neurl4 T A 11: 69,905,874 L487H probably benign Het
Nkx2-9 C T 12: 56,612,132 R99H probably damaging Het
Olfr1215 C G 2: 89,001,511 R259P unknown Het
Olfr686 A T 7: 105,204,160 M61K probably damaging Het
Olfr809 A G 10: 129,776,222 I103V probably benign Het
Pcdhga9 A G 18: 37,738,079 I320M probably damaging Het
Pi15 T A 1: 17,624,913 C251* probably null Het
Pkhd1l1 A T 15: 44,597,138 K4248* probably null Het
Prkg1 C T 19: 30,578,632 V625I probably benign Het
Prkg1 G A 19: 30,624,770 A362V possibly damaging Het
Prol1 C T 5: 88,328,405 T218I unknown Het
Rev3l T A 10: 39,823,485 I1326K probably benign Het
Shank1 C A 7: 44,312,884 R60S unknown Het
Slc24a2 A G 4: 86,991,537 V648A probably damaging Het
Specc1 C T 11: 62,205,397 T895I probably damaging Het
Spta1 A G 1: 174,195,905 E626G possibly damaging Het
Syngr2 C A 11: 117,812,575 S72R possibly damaging Het
Synj2 T A 17: 6,019,534 L490Q unknown Het
Tbc1d9 T C 8: 83,236,712 L351P possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Themis3 G A 17: 66,555,610 T451I probably benign Het
Tia1 T C 6: 86,424,382 S146P probably benign Het
Tpp2 T A 1: 43,983,281 N946K probably benign Het
Tpr A T 1: 150,432,559 R1688S probably damaging Het
Trav12-1 A G 14: 53,538,531 Q47R possibly damaging Het
Ttll9 G A 2: 153,002,358 probably null Het
Ttn G A 2: 76,707,241 T34781M possibly damaging Het
V1ra8 A G 6: 90,203,316 Y167C probably damaging Het
Vegfb T C 19: 6,986,339 D84G probably damaging Het
Vmn2r14 A T 5: 109,220,458 L223M probably benign Het
Wdr26 A G 1: 181,182,822 I554T probably damaging Het
Other mutations in Slc35d3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0080:Slc35d3 UTSW 10 19849198 missense probably damaging 1.00
R1554:Slc35d3 UTSW 10 19850737 missense probably damaging 1.00
R1618:Slc35d3 UTSW 10 19849163 missense probably benign 0.42
R2867:Slc35d3 UTSW 10 19849463 missense probably benign
R2867:Slc35d3 UTSW 10 19849463 missense probably benign
R3930:Slc35d3 UTSW 10 19848859 missense probably damaging 1.00
R4393:Slc35d3 UTSW 10 19849606 unclassified probably null
R4627:Slc35d3 UTSW 10 19849331 missense probably damaging 1.00
R6540:Slc35d3 UTSW 10 19849340 missense possibly damaging 0.94
Z1176:Slc35d3 UTSW 10 19850583 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGCTCCTCCATAACGAAAGG -3'
(R):5'- ACAGTATGTGATCGCCGTC -3'

Sequencing Primer
(F):5'- GCGATTCCAGATCTTCATAGTTG -3'
(R):5'- ATGTGATCGCCGTCTCCGC -3'
Posted On2019-11-26