Mutagenetix > Incidental Mutation

Incidental Mutation 'R7804:Ints2'

600682

Institutional Source

Beutler Lab

Gene Symbol

Ints2

Ensembl Gene

ENSMUSG00000018068

Gene Name

integrator complex subunit 2

Synonyms

2810417D08Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7804 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

86210681-86257575 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 86212663 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1189 (E1189G)

Ref Sequence

ENSEMBL: ENSMUSP00000018212 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039]

AlphaFold

Q80UK8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000018212
AA Change: E1189G

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: E1189G

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1131	N/A	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000108039
AA Change: E1189G

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: E1189G

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1132	N/A	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

95% (55/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933415A04Rik	GTGTGTATGTGT	GTGTGT	11: 43,587,414		probably benign	Het
Ago4	A	T	4: 126,512,630	C296S	probably benign	Het
Apbb1	A	G	7: 105,566,600	L401P	probably damaging	Het
Cacnb2	C	A	2: 14,968,037	P252T	probably benign	Het
Ctnna2	C	T	6: 77,641,374	V202I	probably benign	Het
Dapk1	A	T	13: 60,725,339	I352F	probably benign	Het
Dexi	T	C	16: 10,542,485	D69G	possibly damaging	Het
Dgcr14	T	A	16: 17,911,167	I47F	probably damaging	Het
Dlg5	T	C	14: 24,165,320	E645G	possibly damaging	Het
Dnah3	A	G	7: 119,952,618	I2826T	probably damaging	Het
Dnah3	A	G	7: 120,011,012	W1734R	probably damaging	Het
Dtna	A	G	18: 23,595,609	K287R	probably damaging	Het
Elovl5	A	G	9: 77,979,823		probably null	Het
Fam222b	C	A	11: 78,154,153	P180Q	probably benign	Het
Fat3	C	T	9: 15,990,592	V3046I	probably benign	Het
Fem1a	A	G	17: 56,258,068	D387G	probably damaging	Het
Frmd5	A	G	2: 121,591,744	Y33H	probably damaging	Het
Gucy2g	A	T	19: 55,228,152	L464H	probably benign	Het
Itgb4	T	C	11: 116,003,684	V1355A	probably damaging	Het
Lepr	A	T	4: 101,782,586	S750C	probably damaging	Het
Lingo1	T	C	9: 56,619,514	D603G	probably benign	Het
Map4k3	A	C	17: 80,615,070	V474G	probably damaging	Het
Myl4	T	A	11: 104,584,961	V167E	probably damaging	Het
Naa25	T	C	5: 121,424,589	V478A	probably benign	Het
Neurl4	T	A	11: 69,905,874	L487H	probably benign	Het
Nkx2-9	C	T	12: 56,612,132	R99H	probably damaging	Het
Olfr1215	C	G	2: 89,001,511	R259P	unknown	Het
Olfr686	A	T	7: 105,204,160	M61K	probably damaging	Het
Olfr809	A	G	10: 129,776,222	I103V	probably benign	Het
Pcdhga9	A	G	18: 37,738,079	I320M	probably damaging	Het
Pi15	T	A	1: 17,624,913	C251*	probably null	Het
Pkhd1l1	A	T	15: 44,597,138	K4248*	probably null	Het
Prkg1	C	T	19: 30,578,632	V625I	probably benign	Het
Prkg1	G	A	19: 30,624,770	A362V	possibly damaging	Het
Prol1	C	T	5: 88,328,405	T218I	unknown	Het
Ptpro	G	A	6: 137,399,601		probably null	Het
Rev3l	T	A	10: 39,823,485	I1326K	probably benign	Het
Shank1	C	A	7: 44,312,884	R60S	unknown	Het
Slc24a2	A	G	4: 86,991,537	V648A	probably damaging	Het
Slc35d3	T	C	10: 19,849,370	T247A	probably damaging	Het
Specc1	C	T	11: 62,205,397	T895I	probably damaging	Het
Spta1	A	G	1: 174,195,905	E626G	possibly damaging	Het
Syngr2	C	A	11: 117,812,575	S72R	possibly damaging	Het
Synj2	T	A	17: 6,019,534	L490Q	unknown	Het
Tbc1d9	T	C	8: 83,236,712	L351P	possibly damaging	Het
Tcof1	G	C	18: 60,829,051	A702G	possibly damaging	Het
Themis3	G	A	17: 66,555,610	T451I	probably benign	Het
Tia1	T	C	6: 86,424,382	S146P	probably benign	Het
Tpp2	T	A	1: 43,983,281	N946K	probably benign	Het
Tpr	A	T	1: 150,432,559	R1688S	probably damaging	Het
Trav12-1	A	G	14: 53,538,531	Q47R	possibly damaging	Het
Ttll9	G	A	2: 153,002,358		probably null	Het
Ttn	G	A	2: 76,707,241	T34781M	possibly damaging	Het
V1ra8	A	G	6: 90,203,316	Y167C	probably damaging	Het
Vegfb	T	C	19: 6,986,339	D84G	probably damaging	Het
Vmn2r14	A	T	5: 109,220,458	L223M	probably benign	Het
Wdr26	A	G	1: 181,182,822	I554T	probably damaging	Het

Other mutations in Ints2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00807:Ints2	APN	11	86233135	missense	probably damaging	1.00
IGL02490:Ints2	APN	11	86233183	missense	possibly damaging	0.93
IGL02612:Ints2	APN	11	86215578	missense	probably damaging	1.00
IGL03396:Ints2	APN	11	86213062	missense	probably damaging	0.99
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0355:Ints2	UTSW	11	86234749	missense	probably benign	0.00
R0389:Ints2	UTSW	11	86248851	missense	probably damaging	1.00
R0631:Ints2	UTSW	11	86233196	missense	probably benign	0.02
R0944:Ints2	UTSW	11	86244463	missense	possibly damaging	0.85
R1268:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1269:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1270:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1396:Ints2	UTSW	11	86249248	missense	probably damaging	0.98
R1474:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1503:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1840:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1987:Ints2	UTSW	11	86217800	missense	probably benign	0.03
R1990:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R1991:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R3694:Ints2	UTSW	11	86243001	missense	probably benign	0.41
R4056:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4057:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4569:Ints2	UTSW	11	86256198	missense	probably damaging	1.00
R4585:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4586:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4806:Ints2	UTSW	11	86256209	missense	probably benign	0.10
R4929:Ints2	UTSW	11	86212653	missense	possibly damaging	0.56
R5031:Ints2	UTSW	11	86256200	missense	probably damaging	1.00
R5064:Ints2	UTSW	11	86249274	missense	probably damaging	1.00
R5270:Ints2	UTSW	11	86215795	missense	probably damaging	1.00
R5621:Ints2	UTSW	11	86242947	missense	probably benign	0.32
R5875:Ints2	UTSW	11	86238312	missense	probably benign	0.04
R5908:Ints2	UTSW	11	86215545	critical splice donor site	probably null
R5914:Ints2	UTSW	11	86222174	missense	probably benign	0.03
R5941:Ints2	UTSW	11	86250972	missense	probably benign	0.01
R5975:Ints2	UTSW	11	86226748	missense	possibly damaging	0.72
R6003:Ints2	UTSW	11	86238468	missense	probably damaging	1.00
R6091:Ints2	UTSW	11	86236603	missense	probably damaging	0.96
R6209:Ints2	UTSW	11	86225058	missense	probably damaging	1.00
R6567:Ints2	UTSW	11	86226661	missense	probably benign	0.42
R6764:Ints2	UTSW	11	86212779	missense	probably benign	0.00
R7033:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R7132:Ints2	UTSW	11	86217754	missense	probably benign	0.26
R7337:Ints2	UTSW	11	86217842	missense	probably benign	0.00
R7410:Ints2	UTSW	11	86233226	missense	probably benign	0.02
R7483:Ints2	UTSW	11	86215618	missense	probably damaging	1.00
R7503:Ints2	UTSW	11	86232055	missense	probably benign
R7845:Ints2	UTSW	11	86238263	missense	possibly damaging	0.93
R7875:Ints2	UTSW	11	86213062	missense	probably damaging	0.99
R7918:Ints2	UTSW	11	86222217	missense	probably damaging	1.00
R7922:Ints2	UTSW	11	86244627	missense	probably benign	0.29
R8058:Ints2	UTSW	11	86255353	missense	probably benign	0.05
R8134:Ints2	UTSW	11	86212660	missense	probably damaging	1.00
R8189:Ints2	UTSW	11	86215570	missense	probably damaging	1.00
R8295:Ints2	UTSW	11	86225088	missense	probably damaging	0.97
R8348:Ints2	UTSW	11	86255423	missense	probably benign
R8448:Ints2	UTSW	11	86255423	missense	probably benign
R8784:Ints2	UTSW	11	86222137	missense	probably damaging	1.00
R8784:Ints2	UTSW	11	86225115	nonsense	probably null
R8942:Ints2	UTSW	11	86212894	missense	probably benign	0.00
R9037:Ints2	UTSW	11	86215704	missense	probably benign
R9154:Ints2	UTSW	11	86234698	missense	probably damaging	1.00
R9397:Ints2	UTSW	11	86244485	missense	probably benign	0.01
R9412:Ints2	UTSW	11	86226763	missense	probably damaging	0.99
R9472:Ints2	UTSW	11	86242998	missense
R9476:Ints2	UTSW	11	86244509	missense	probably benign
R9510:Ints2	UTSW	11	86244509	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CCATCAGAGCAGATCCAAAGATATG -3'
(R):5'- CCTCTGATGTTGCCACTCAG -3'

Sequencing Primer
(F):5'- TCAAACAAGTATAATTCTCAGAGAGC -3'
(R):5'- TCTGATGTTGCCACTCAGACAAGAG -3'

Posted On

2019-11-26