Incidental Mutation 'R7804:Ints2'
ID 600682
Institutional Source Beutler Lab
Gene Symbol Ints2
Ensembl Gene ENSMUSG00000018068
Gene Name integrator complex subunit 2
Synonyms 2810417D08Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7804 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 86210681-86257575 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 86212663 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1189 (E1189G)
Ref Sequence ENSEMBL: ENSMUSP00000018212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039]
AlphaFold Q80UK8
Predicted Effect possibly damaging
Transcript: ENSMUST00000018212
AA Change: E1189G

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: E1189G

DomainStartEndE-ValueType
Pfam:INTS2 24 1131 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108039
AA Change: E1189G

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: E1189G

DomainStartEndE-ValueType
Pfam:INTS2 24 1132 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 95% (55/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933415A04Rik GTGTGTATGTGT GTGTGT 11: 43,587,414 probably benign Het
Ago4 A T 4: 126,512,630 C296S probably benign Het
Apbb1 A G 7: 105,566,600 L401P probably damaging Het
Cacnb2 C A 2: 14,968,037 P252T probably benign Het
Ctnna2 C T 6: 77,641,374 V202I probably benign Het
Dapk1 A T 13: 60,725,339 I352F probably benign Het
Dexi T C 16: 10,542,485 D69G possibly damaging Het
Dgcr14 T A 16: 17,911,167 I47F probably damaging Het
Dlg5 T C 14: 24,165,320 E645G possibly damaging Het
Dnah3 A G 7: 119,952,618 I2826T probably damaging Het
Dnah3 A G 7: 120,011,012 W1734R probably damaging Het
Dtna A G 18: 23,595,609 K287R probably damaging Het
Elovl5 A G 9: 77,979,823 probably null Het
Fam222b C A 11: 78,154,153 P180Q probably benign Het
Fat3 C T 9: 15,990,592 V3046I probably benign Het
Fem1a A G 17: 56,258,068 D387G probably damaging Het
Frmd5 A G 2: 121,591,744 Y33H probably damaging Het
Gucy2g A T 19: 55,228,152 L464H probably benign Het
Itgb4 T C 11: 116,003,684 V1355A probably damaging Het
Lepr A T 4: 101,782,586 S750C probably damaging Het
Lingo1 T C 9: 56,619,514 D603G probably benign Het
Map4k3 A C 17: 80,615,070 V474G probably damaging Het
Myl4 T A 11: 104,584,961 V167E probably damaging Het
Naa25 T C 5: 121,424,589 V478A probably benign Het
Neurl4 T A 11: 69,905,874 L487H probably benign Het
Nkx2-9 C T 12: 56,612,132 R99H probably damaging Het
Olfr1215 C G 2: 89,001,511 R259P unknown Het
Olfr686 A T 7: 105,204,160 M61K probably damaging Het
Olfr809 A G 10: 129,776,222 I103V probably benign Het
Pcdhga9 A G 18: 37,738,079 I320M probably damaging Het
Pi15 T A 1: 17,624,913 C251* probably null Het
Pkhd1l1 A T 15: 44,597,138 K4248* probably null Het
Prkg1 C T 19: 30,578,632 V625I probably benign Het
Prkg1 G A 19: 30,624,770 A362V possibly damaging Het
Prol1 C T 5: 88,328,405 T218I unknown Het
Ptpro G A 6: 137,399,601 probably null Het
Rev3l T A 10: 39,823,485 I1326K probably benign Het
Shank1 C A 7: 44,312,884 R60S unknown Het
Slc24a2 A G 4: 86,991,537 V648A probably damaging Het
Slc35d3 T C 10: 19,849,370 T247A probably damaging Het
Specc1 C T 11: 62,205,397 T895I probably damaging Het
Spta1 A G 1: 174,195,905 E626G possibly damaging Het
Syngr2 C A 11: 117,812,575 S72R possibly damaging Het
Synj2 T A 17: 6,019,534 L490Q unknown Het
Tbc1d9 T C 8: 83,236,712 L351P possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Themis3 G A 17: 66,555,610 T451I probably benign Het
Tia1 T C 6: 86,424,382 S146P probably benign Het
Tpp2 T A 1: 43,983,281 N946K probably benign Het
Tpr A T 1: 150,432,559 R1688S probably damaging Het
Trav12-1 A G 14: 53,538,531 Q47R possibly damaging Het
Ttll9 G A 2: 153,002,358 probably null Het
Ttn G A 2: 76,707,241 T34781M possibly damaging Het
V1ra8 A G 6: 90,203,316 Y167C probably damaging Het
Vegfb T C 19: 6,986,339 D84G probably damaging Het
Vmn2r14 A T 5: 109,220,458 L223M probably benign Het
Wdr26 A G 1: 181,182,822 I554T probably damaging Het
Other mutations in Ints2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Ints2 APN 11 86233135 missense probably damaging 1.00
IGL02490:Ints2 APN 11 86233183 missense possibly damaging 0.93
IGL02612:Ints2 APN 11 86215578 missense probably damaging 1.00
IGL03396:Ints2 APN 11 86213062 missense probably damaging 0.99
R0015:Ints2 UTSW 11 86249287 missense probably damaging 1.00
R0015:Ints2 UTSW 11 86249287 missense probably damaging 1.00
R0355:Ints2 UTSW 11 86234749 missense probably benign 0.00
R0389:Ints2 UTSW 11 86248851 missense probably damaging 1.00
R0631:Ints2 UTSW 11 86233196 missense probably benign 0.02
R0944:Ints2 UTSW 11 86244463 missense possibly damaging 0.85
R1268:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1269:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1270:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1396:Ints2 UTSW 11 86249248 missense probably damaging 0.98
R1474:Ints2 UTSW 11 86226781 missense probably damaging 0.97
R1503:Ints2 UTSW 11 86226781 missense probably damaging 0.97
R1840:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1987:Ints2 UTSW 11 86217800 missense probably benign 0.03
R1990:Ints2 UTSW 11 86248934 missense possibly damaging 0.58
R1991:Ints2 UTSW 11 86248934 missense possibly damaging 0.58
R3694:Ints2 UTSW 11 86243001 missense probably benign 0.41
R4056:Ints2 UTSW 11 86242952 missense probably damaging 1.00
R4057:Ints2 UTSW 11 86242952 missense probably damaging 1.00
R4569:Ints2 UTSW 11 86256198 missense probably damaging 1.00
R4585:Ints2 UTSW 11 86249275 missense probably damaging 1.00
R4586:Ints2 UTSW 11 86249275 missense probably damaging 1.00
R4806:Ints2 UTSW 11 86256209 missense probably benign 0.10
R4929:Ints2 UTSW 11 86212653 missense possibly damaging 0.56
R5031:Ints2 UTSW 11 86256200 missense probably damaging 1.00
R5064:Ints2 UTSW 11 86249274 missense probably damaging 1.00
R5270:Ints2 UTSW 11 86215795 missense probably damaging 1.00
R5621:Ints2 UTSW 11 86242947 missense probably benign 0.32
R5875:Ints2 UTSW 11 86238312 missense probably benign 0.04
R5908:Ints2 UTSW 11 86215545 critical splice donor site probably null
R5914:Ints2 UTSW 11 86222174 missense probably benign 0.03
R5941:Ints2 UTSW 11 86250972 missense probably benign 0.01
R5975:Ints2 UTSW 11 86226748 missense possibly damaging 0.72
R6003:Ints2 UTSW 11 86238468 missense probably damaging 1.00
R6091:Ints2 UTSW 11 86236603 missense probably damaging 0.96
R6209:Ints2 UTSW 11 86225058 missense probably damaging 1.00
R6567:Ints2 UTSW 11 86226661 missense probably benign 0.42
R6764:Ints2 UTSW 11 86212779 missense probably benign 0.00
R7033:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R7132:Ints2 UTSW 11 86217754 missense probably benign 0.26
R7337:Ints2 UTSW 11 86217842 missense probably benign 0.00
R7410:Ints2 UTSW 11 86233226 missense probably benign 0.02
R7483:Ints2 UTSW 11 86215618 missense probably damaging 1.00
R7503:Ints2 UTSW 11 86232055 missense probably benign
R7845:Ints2 UTSW 11 86238263 missense possibly damaging 0.93
R7875:Ints2 UTSW 11 86213062 missense probably damaging 0.99
R7918:Ints2 UTSW 11 86222217 missense probably damaging 1.00
R7922:Ints2 UTSW 11 86244627 missense probably benign 0.29
R8058:Ints2 UTSW 11 86255353 missense probably benign 0.05
R8134:Ints2 UTSW 11 86212660 missense probably damaging 1.00
R8189:Ints2 UTSW 11 86215570 missense probably damaging 1.00
R8295:Ints2 UTSW 11 86225088 missense probably damaging 0.97
R8348:Ints2 UTSW 11 86255423 missense probably benign
R8448:Ints2 UTSW 11 86255423 missense probably benign
R8784:Ints2 UTSW 11 86222137 missense probably damaging 1.00
R8784:Ints2 UTSW 11 86225115 nonsense probably null
R8942:Ints2 UTSW 11 86212894 missense probably benign 0.00
R9037:Ints2 UTSW 11 86215704 missense probably benign
R9154:Ints2 UTSW 11 86234698 missense probably damaging 1.00
R9397:Ints2 UTSW 11 86244485 missense probably benign 0.01
R9412:Ints2 UTSW 11 86226763 missense probably damaging 0.99
R9472:Ints2 UTSW 11 86242998 missense
R9476:Ints2 UTSW 11 86244509 missense probably benign
R9510:Ints2 UTSW 11 86244509 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCATCAGAGCAGATCCAAAGATATG -3'
(R):5'- CCTCTGATGTTGCCACTCAG -3'

Sequencing Primer
(F):5'- TCAAACAAGTATAATTCTCAGAGAGC -3'
(R):5'- TCTGATGTTGCCACTCAGACAAGAG -3'
Posted On 2019-11-26