Incidental Mutation 'R7804:Ints2'
ID 600682
Institutional Source Beutler Lab
Gene Symbol Ints2
Ensembl Gene ENSMUSG00000018068
Gene Name integrator complex subunit 2
Synonyms 2810417D08Rik
MMRRC Submission 045859-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7804 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 86101507-86148401 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 86103489 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1189 (E1189G)
Ref Sequence ENSEMBL: ENSMUSP00000018212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039]
AlphaFold Q80UK8
Predicted Effect possibly damaging
Transcript: ENSMUST00000018212
AA Change: E1189G

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: E1189G

DomainStartEndE-ValueType
Pfam:INTS2 24 1131 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108039
AA Change: E1189G

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: E1189G

DomainStartEndE-ValueType
Pfam:INTS2 24 1132 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 95% (55/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933415A04Rik GTGTGTATGTGT GTGTGT 11: 43,478,241 (GRCm39) probably benign Het
Ago4 A T 4: 126,406,423 (GRCm39) C296S probably benign Het
Apbb1 A G 7: 105,215,807 (GRCm39) L401P probably damaging Het
Cacnb2 C A 2: 14,972,848 (GRCm39) P252T probably benign Het
Ctnna2 C T 6: 77,618,357 (GRCm39) V202I probably benign Het
Dapk1 A T 13: 60,873,153 (GRCm39) I352F probably benign Het
Dexi T C 16: 10,360,349 (GRCm39) D69G possibly damaging Het
Dlg5 T C 14: 24,215,388 (GRCm39) E645G possibly damaging Het
Dnah3 A G 7: 119,551,841 (GRCm39) I2826T probably damaging Het
Dnah3 A G 7: 119,610,235 (GRCm39) W1734R probably damaging Het
Dtna A G 18: 23,728,666 (GRCm39) K287R probably damaging Het
Elovl5 A G 9: 77,887,105 (GRCm39) probably null Het
Ess2 T A 16: 17,729,031 (GRCm39) I47F probably damaging Het
Fam222b C A 11: 78,044,979 (GRCm39) P180Q probably benign Het
Fat3 C T 9: 15,901,888 (GRCm39) V3046I probably benign Het
Fem1a A G 17: 56,565,068 (GRCm39) D387G probably damaging Het
Frmd5 A G 2: 121,422,225 (GRCm39) Y33H probably damaging Het
Gucy2g A T 19: 55,216,584 (GRCm39) L464H probably benign Het
Itgb4 T C 11: 115,894,510 (GRCm39) V1355A probably damaging Het
Lepr A T 4: 101,639,783 (GRCm39) S750C probably damaging Het
Lingo1 T C 9: 56,526,798 (GRCm39) D603G probably benign Het
Map4k3 A C 17: 80,922,499 (GRCm39) V474G probably damaging Het
Myl4 T A 11: 104,475,787 (GRCm39) V167E probably damaging Het
Naa25 T C 5: 121,562,652 (GRCm39) V478A probably benign Het
Neurl4 T A 11: 69,796,700 (GRCm39) L487H probably benign Het
Nkx2-9 C T 12: 56,658,917 (GRCm39) R99H probably damaging Het
Or4c110 C G 2: 88,831,855 (GRCm39) R259P unknown Het
Or52x1 A T 7: 104,853,367 (GRCm39) M61K probably damaging Het
Or6c76 A G 10: 129,612,091 (GRCm39) I103V probably benign Het
Pcdhga9 A G 18: 37,871,132 (GRCm39) I320M probably damaging Het
Pi15 T A 1: 17,695,137 (GRCm39) C251* probably null Het
Pkhd1l1 A T 15: 44,460,534 (GRCm39) K4248* probably null Het
Prkg1 C T 19: 30,556,032 (GRCm39) V625I probably benign Het
Prkg1 G A 19: 30,602,170 (GRCm39) A362V possibly damaging Het
Prol1 C T 5: 88,476,264 (GRCm39) T218I unknown Het
Ptpro G A 6: 137,376,599 (GRCm39) probably null Het
Rev3l T A 10: 39,699,481 (GRCm39) I1326K probably benign Het
Shank1 C A 7: 43,962,308 (GRCm39) R60S unknown Het
Slc24a2 A G 4: 86,909,774 (GRCm39) V648A probably damaging Het
Slc35d3 T C 10: 19,725,116 (GRCm39) T247A probably damaging Het
Specc1 C T 11: 62,096,223 (GRCm39) T895I probably damaging Het
Spta1 A G 1: 174,023,471 (GRCm39) E626G possibly damaging Het
Syngr2 C A 11: 117,703,401 (GRCm39) S72R possibly damaging Het
Synj2 T A 17: 6,069,809 (GRCm39) L490Q unknown Het
Tbc1d9 T C 8: 83,963,341 (GRCm39) L351P possibly damaging Het
Tcof1 G C 18: 60,962,123 (GRCm39) A702G possibly damaging Het
Themis3 G A 17: 66,862,605 (GRCm39) T451I probably benign Het
Tia1 T C 6: 86,401,364 (GRCm39) S146P probably benign Het
Tpp2 T A 1: 44,022,441 (GRCm39) N946K probably benign Het
Tpr A T 1: 150,308,310 (GRCm39) R1688S probably damaging Het
Trav12-1 A G 14: 53,775,988 (GRCm39) Q47R possibly damaging Het
Ttll9 G A 2: 152,844,278 (GRCm39) probably null Het
Ttn G A 2: 76,537,585 (GRCm39) T34781M possibly damaging Het
V1ra8 A G 6: 90,180,298 (GRCm39) Y167C probably damaging Het
Vegfb T C 19: 6,963,707 (GRCm39) D84G probably damaging Het
Vmn2r14 A T 5: 109,368,324 (GRCm39) L223M probably benign Het
Wdr26 A G 1: 181,010,387 (GRCm39) I554T probably damaging Het
Other mutations in Ints2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Ints2 APN 11 86,123,961 (GRCm39) missense probably damaging 1.00
IGL02490:Ints2 APN 11 86,124,009 (GRCm39) missense possibly damaging 0.93
IGL02612:Ints2 APN 11 86,106,404 (GRCm39) missense probably damaging 1.00
IGL03396:Ints2 APN 11 86,103,888 (GRCm39) missense probably damaging 0.99
R0015:Ints2 UTSW 11 86,140,113 (GRCm39) missense probably damaging 1.00
R0015:Ints2 UTSW 11 86,140,113 (GRCm39) missense probably damaging 1.00
R0355:Ints2 UTSW 11 86,125,575 (GRCm39) missense probably benign 0.00
R0389:Ints2 UTSW 11 86,139,677 (GRCm39) missense probably damaging 1.00
R0631:Ints2 UTSW 11 86,124,022 (GRCm39) missense probably benign 0.02
R0944:Ints2 UTSW 11 86,135,289 (GRCm39) missense possibly damaging 0.85
R1268:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R1269:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R1270:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R1396:Ints2 UTSW 11 86,140,074 (GRCm39) missense probably damaging 0.98
R1474:Ints2 UTSW 11 86,117,607 (GRCm39) missense probably damaging 0.97
R1503:Ints2 UTSW 11 86,117,607 (GRCm39) missense probably damaging 0.97
R1840:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R1987:Ints2 UTSW 11 86,108,626 (GRCm39) missense probably benign 0.03
R1990:Ints2 UTSW 11 86,139,760 (GRCm39) missense possibly damaging 0.58
R1991:Ints2 UTSW 11 86,139,760 (GRCm39) missense possibly damaging 0.58
R3694:Ints2 UTSW 11 86,133,827 (GRCm39) missense probably benign 0.41
R4056:Ints2 UTSW 11 86,133,778 (GRCm39) missense probably damaging 1.00
R4057:Ints2 UTSW 11 86,133,778 (GRCm39) missense probably damaging 1.00
R4569:Ints2 UTSW 11 86,147,024 (GRCm39) missense probably damaging 1.00
R4585:Ints2 UTSW 11 86,140,101 (GRCm39) missense probably damaging 1.00
R4586:Ints2 UTSW 11 86,140,101 (GRCm39) missense probably damaging 1.00
R4806:Ints2 UTSW 11 86,147,035 (GRCm39) missense probably benign 0.10
R4929:Ints2 UTSW 11 86,103,479 (GRCm39) missense possibly damaging 0.56
R5031:Ints2 UTSW 11 86,147,026 (GRCm39) missense probably damaging 1.00
R5064:Ints2 UTSW 11 86,140,100 (GRCm39) missense probably damaging 1.00
R5270:Ints2 UTSW 11 86,106,621 (GRCm39) missense probably damaging 1.00
R5621:Ints2 UTSW 11 86,133,773 (GRCm39) missense probably benign 0.32
R5875:Ints2 UTSW 11 86,129,138 (GRCm39) missense probably benign 0.04
R5908:Ints2 UTSW 11 86,106,371 (GRCm39) critical splice donor site probably null
R5914:Ints2 UTSW 11 86,113,000 (GRCm39) missense probably benign 0.03
R5941:Ints2 UTSW 11 86,141,798 (GRCm39) missense probably benign 0.01
R5975:Ints2 UTSW 11 86,117,574 (GRCm39) missense possibly damaging 0.72
R6003:Ints2 UTSW 11 86,129,294 (GRCm39) missense probably damaging 1.00
R6091:Ints2 UTSW 11 86,127,429 (GRCm39) missense probably damaging 0.96
R6209:Ints2 UTSW 11 86,115,884 (GRCm39) missense probably damaging 1.00
R6567:Ints2 UTSW 11 86,117,487 (GRCm39) missense probably benign 0.42
R6764:Ints2 UTSW 11 86,103,605 (GRCm39) missense probably benign 0.00
R7033:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R7132:Ints2 UTSW 11 86,108,580 (GRCm39) missense probably benign 0.26
R7337:Ints2 UTSW 11 86,108,668 (GRCm39) missense probably benign 0.00
R7410:Ints2 UTSW 11 86,124,052 (GRCm39) missense probably benign 0.02
R7483:Ints2 UTSW 11 86,106,444 (GRCm39) missense probably damaging 1.00
R7503:Ints2 UTSW 11 86,122,881 (GRCm39) missense probably benign
R7845:Ints2 UTSW 11 86,129,089 (GRCm39) missense possibly damaging 0.93
R7875:Ints2 UTSW 11 86,103,888 (GRCm39) missense probably damaging 0.99
R7918:Ints2 UTSW 11 86,113,043 (GRCm39) missense probably damaging 1.00
R7922:Ints2 UTSW 11 86,135,453 (GRCm39) missense probably benign 0.29
R8058:Ints2 UTSW 11 86,146,179 (GRCm39) missense probably benign 0.05
R8134:Ints2 UTSW 11 86,103,486 (GRCm39) missense probably damaging 1.00
R8189:Ints2 UTSW 11 86,106,396 (GRCm39) missense probably damaging 1.00
R8295:Ints2 UTSW 11 86,115,914 (GRCm39) missense probably damaging 0.97
R8348:Ints2 UTSW 11 86,146,249 (GRCm39) missense probably benign
R8448:Ints2 UTSW 11 86,146,249 (GRCm39) missense probably benign
R8784:Ints2 UTSW 11 86,115,941 (GRCm39) nonsense probably null
R8784:Ints2 UTSW 11 86,112,963 (GRCm39) missense probably damaging 1.00
R8942:Ints2 UTSW 11 86,103,720 (GRCm39) missense probably benign 0.00
R9037:Ints2 UTSW 11 86,106,530 (GRCm39) missense probably benign
R9154:Ints2 UTSW 11 86,125,524 (GRCm39) missense probably damaging 1.00
R9397:Ints2 UTSW 11 86,135,311 (GRCm39) missense probably benign 0.01
R9412:Ints2 UTSW 11 86,117,589 (GRCm39) missense probably damaging 0.99
R9472:Ints2 UTSW 11 86,133,824 (GRCm39) missense
R9476:Ints2 UTSW 11 86,135,335 (GRCm39) missense probably benign
R9510:Ints2 UTSW 11 86,135,335 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CCATCAGAGCAGATCCAAAGATATG -3'
(R):5'- CCTCTGATGTTGCCACTCAG -3'

Sequencing Primer
(F):5'- TCAAACAAGTATAATTCTCAGAGAGC -3'
(R):5'- TCTGATGTTGCCACTCAGACAAGAG -3'
Posted On 2019-11-26