Incidental Mutation 'R7804:Nkx2-9'
ID600686
Institutional Source Beutler Lab
Gene Symbol Nkx2-9
Ensembl Gene ENSMUSG00000058669
Gene NameNK2 homeobox 9
SynonymsNkx2.9, Nkx-2.9, tinman
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7804 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location56611389-56613284 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 56612132 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 99 (R99H)
Ref Sequence ENSEMBL: ENSMUSP00000072425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072631]
Predicted Effect probably damaging
Transcript: ENSMUST00000072631
AA Change: R99H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072425
Gene: ENSMUSG00000058669
AA Change: R99H

DomainStartEndE-ValueType
HOX 81 143 5.04e-23 SMART
low complexity region 162 177 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 95% (55/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a homeobox-containing developmental regulator associated with liver development. The encoded protein binds to the alpha-fetoprotein (AFP) gene promoter and increases the expression of AFP. This gene is overexpressed in some lung cancers and is linked to poor patient survival, possibly due to its resistance to cisplatin. This gene is aberrantly methylated in pancreatic cancer, deleted in squamous cell lung carcinomas, and acts as a tumor suppressor in esophageal cancer. Mutations in this gene may also be a cause of neural tube defects. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mutant mice lacking both functional copies of the gene are viable and fertile but display abnormal development of the spinal accessory nerve. Another mutant exhibits progressive bronchial dysplasia leading to lung cancer in aged mutants. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933415A04Rik GTGTGTATGTGT GTGTGT 11: 43,587,414 probably benign Het
Ago4 A T 4: 126,512,630 C296S probably benign Het
Apbb1 A G 7: 105,566,600 L401P probably damaging Het
Cacnb2 C A 2: 14,968,037 P252T probably benign Het
Ctnna2 C T 6: 77,641,374 V202I probably benign Het
Dapk1 A T 13: 60,725,339 I352F probably benign Het
Dexi T C 16: 10,542,485 D69G possibly damaging Het
Dgcr14 T A 16: 17,911,167 I47F probably damaging Het
Dlg5 T C 14: 24,165,320 E645G possibly damaging Het
Dnah3 A G 7: 119,952,618 I2826T probably damaging Het
Dnah3 A G 7: 120,011,012 W1734R probably damaging Het
Dtna A G 18: 23,595,609 K287R probably damaging Het
Elovl5 A G 9: 77,979,823 probably null Het
Fam222b C A 11: 78,154,153 P180Q probably benign Het
Fat3 C T 9: 15,990,592 V3046I probably benign Het
Fem1a A G 17: 56,258,068 D387G probably damaging Het
Frmd5 A G 2: 121,591,744 Y33H probably damaging Het
Gucy2g A T 19: 55,228,152 L464H probably benign Het
Ints2 T C 11: 86,212,663 E1189G possibly damaging Het
Itgb4 T C 11: 116,003,684 V1355A probably damaging Het
Lepr A T 4: 101,782,586 S750C probably damaging Het
Lingo1 T C 9: 56,619,514 D603G probably benign Het
Map4k3 A C 17: 80,615,070 V474G probably damaging Het
Myl4 T A 11: 104,584,961 V167E probably damaging Het
Naa25 T C 5: 121,424,589 V478A probably benign Het
Neurl4 T A 11: 69,905,874 L487H probably benign Het
Olfr1215 C G 2: 89,001,511 R259P unknown Het
Olfr686 A T 7: 105,204,160 M61K probably damaging Het
Olfr809 A G 10: 129,776,222 I103V probably benign Het
Pcdhga9 A G 18: 37,738,079 I320M probably damaging Het
Pi15 T A 1: 17,624,913 C251* probably null Het
Pkhd1l1 A T 15: 44,597,138 K4248* probably null Het
Prkg1 C T 19: 30,578,632 V625I probably benign Het
Prkg1 G A 19: 30,624,770 A362V possibly damaging Het
Prol1 C T 5: 88,328,405 T218I unknown Het
Ptpro G A 6: 137,399,601 probably null Het
Rev3l T A 10: 39,823,485 I1326K probably benign Het
Shank1 C A 7: 44,312,884 R60S unknown Het
Slc24a2 A G 4: 86,991,537 V648A probably damaging Het
Slc35d3 T C 10: 19,849,370 T247A probably damaging Het
Specc1 C T 11: 62,205,397 T895I probably damaging Het
Spta1 A G 1: 174,195,905 E626G possibly damaging Het
Syngr2 C A 11: 117,812,575 S72R possibly damaging Het
Synj2 T A 17: 6,019,534 L490Q unknown Het
Tbc1d9 T C 8: 83,236,712 L351P possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Themis3 G A 17: 66,555,610 T451I probably benign Het
Tia1 T C 6: 86,424,382 S146P probably benign Het
Tpp2 T A 1: 43,983,281 N946K probably benign Het
Tpr A T 1: 150,432,559 R1688S probably damaging Het
Trav12-1 A G 14: 53,538,531 Q47R possibly damaging Het
Ttll9 G A 2: 153,002,358 probably null Het
Ttn G A 2: 76,707,241 T34781M possibly damaging Het
V1ra8 A G 6: 90,203,316 Y167C probably damaging Het
Vegfb T C 19: 6,986,339 D84G probably damaging Het
Vmn2r14 A T 5: 109,220,458 L223M probably benign Het
Wdr26 A G 1: 181,182,822 I554T probably damaging Het
Other mutations in Nkx2-9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02806:Nkx2-9 APN 12 56611920 missense probably damaging 1.00
R1633:Nkx2-9 UTSW 12 56612981 missense probably benign 0.01
R2349:Nkx2-9 UTSW 12 56612222 missense probably benign 0.00
R6663:Nkx2-9 UTSW 12 56611938 missense probably benign 0.12
R6872:Nkx2-9 UTSW 12 56611889 missense probably benign
R7898:Nkx2-9 UTSW 12 56612246 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CAGATGATGCTGCCATATCCG -3'
(R):5'- AGAATTGGGACTCCAGGTGG -3'

Sequencing Primer
(F):5'- GAAGGCTCTGTGATCCCAG -3'
(R):5'- AGACACCCGTAGAGGCTG -3'
Posted On2019-11-26