Incidental Mutation 'R7804:Dgcr14'
ID600692
Institutional Source Beutler Lab
Gene Symbol Dgcr14
Ensembl Gene ENSMUSG00000003527
Gene NameDiGeorge syndrome critical region gene 14
SynonymsDgsi, ES2, Es2el, D16H22S1269E
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.945) question?
Stock #R7804 (G1)
Quality Score158.009
Status Validated
Chromosome16
Chromosomal Location17900709-17911348 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 17911167 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 47 (I47F)
Ref Sequence ENSEMBL: ENSMUSP00000003621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003621] [ENSMUST00000012279] [ENSMUST00000232423] [ENSMUST00000232493]
Predicted Effect probably damaging
Transcript: ENSMUST00000003621
AA Change: I47F

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000003621
Gene: ENSMUSG00000003527
AA Change: I47F

DomainStartEndE-ValueType
low complexity region 7 34 N/A INTRINSIC
Pfam:Es2 37 405 1.9e-76 PFAM
low complexity region 434 455 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000012279
SMART Domains Protein: ENSMUSP00000012279
Gene: ENSMUSG00000022738

DomainStartEndE-ValueType
low complexity region 59 85 N/A INTRINSIC
low complexity region 95 119 N/A INTRINSIC
HOX 136 198 2.9e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000232423
AA Change: I47F

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000232493
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 95% (55/58)
MGI Phenotype FUNCTION: The human ortholog of this gene is located within the minimal DGS critical region (MDGCR) thought to contain the gene(s) responsible for a group of developmental disorders. These disorders include DiGeorge syndrome, velocardiofacial syndrome, conotruncal anomaly face syndrome, and some familial or sporadic conotruncal cardiac defects which have been associated with microdeletion of human chromosome band 22q11.2. The encoded protein localizes to the nucleus, and the orthologous protein in humans co-purifies with C complex spliceosomes. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933415A04Rik GTGTGTATGTGT GTGTGT 11: 43,587,414 probably benign Het
Ago4 A T 4: 126,512,630 C296S probably benign Het
Apbb1 A G 7: 105,566,600 L401P probably damaging Het
Cacnb2 C A 2: 14,968,037 P252T probably benign Het
Ctnna2 C T 6: 77,641,374 V202I probably benign Het
Dapk1 A T 13: 60,725,339 I352F probably benign Het
Dexi T C 16: 10,542,485 D69G possibly damaging Het
Dlg5 T C 14: 24,165,320 E645G possibly damaging Het
Dnah3 A G 7: 119,952,618 I2826T probably damaging Het
Dnah3 A G 7: 120,011,012 W1734R probably damaging Het
Dtna A G 18: 23,595,609 K287R probably damaging Het
Elovl5 A G 9: 77,979,823 probably null Het
Fam222b C A 11: 78,154,153 P180Q probably benign Het
Fat3 C T 9: 15,990,592 V3046I probably benign Het
Fem1a A G 17: 56,258,068 D387G probably damaging Het
Frmd5 A G 2: 121,591,744 Y33H probably damaging Het
Gucy2g A T 19: 55,228,152 L464H probably benign Het
Ints2 T C 11: 86,212,663 E1189G possibly damaging Het
Itgb4 T C 11: 116,003,684 V1355A probably damaging Het
Lepr A T 4: 101,782,586 S750C probably damaging Het
Lingo1 T C 9: 56,619,514 D603G probably benign Het
Map4k3 A C 17: 80,615,070 V474G probably damaging Het
Myl4 T A 11: 104,584,961 V167E probably damaging Het
Naa25 T C 5: 121,424,589 V478A probably benign Het
Neurl4 T A 11: 69,905,874 L487H probably benign Het
Nkx2-9 C T 12: 56,612,132 R99H probably damaging Het
Olfr1215 C G 2: 89,001,511 R259P unknown Het
Olfr686 A T 7: 105,204,160 M61K probably damaging Het
Olfr809 A G 10: 129,776,222 I103V probably benign Het
Pcdhga9 A G 18: 37,738,079 I320M probably damaging Het
Pi15 T A 1: 17,624,913 C251* probably null Het
Pkhd1l1 A T 15: 44,597,138 K4248* probably null Het
Prkg1 C T 19: 30,578,632 V625I probably benign Het
Prkg1 G A 19: 30,624,770 A362V possibly damaging Het
Prol1 C T 5: 88,328,405 T218I unknown Het
Ptpro G A 6: 137,399,601 probably null Het
Rev3l T A 10: 39,823,485 I1326K probably benign Het
Shank1 C A 7: 44,312,884 R60S unknown Het
Slc24a2 A G 4: 86,991,537 V648A probably damaging Het
Slc35d3 T C 10: 19,849,370 T247A probably damaging Het
Specc1 C T 11: 62,205,397 T895I probably damaging Het
Spta1 A G 1: 174,195,905 E626G possibly damaging Het
Syngr2 C A 11: 117,812,575 S72R possibly damaging Het
Synj2 T A 17: 6,019,534 L490Q unknown Het
Tbc1d9 T C 8: 83,236,712 L351P possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Themis3 G A 17: 66,555,610 T451I probably benign Het
Tia1 T C 6: 86,424,382 S146P probably benign Het
Tpp2 T A 1: 43,983,281 N946K probably benign Het
Tpr A T 1: 150,432,559 R1688S probably damaging Het
Trav12-1 A G 14: 53,538,531 Q47R possibly damaging Het
Ttll9 G A 2: 153,002,358 probably null Het
Ttn G A 2: 76,707,241 T34781M possibly damaging Het
V1ra8 A G 6: 90,203,316 Y167C probably damaging Het
Vegfb T C 19: 6,986,339 D84G probably damaging Het
Vmn2r14 A T 5: 109,220,458 L223M probably benign Het
Wdr26 A G 1: 181,182,822 I554T probably damaging Het
Other mutations in Dgcr14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:Dgcr14 APN 16 17902932 missense probably damaging 1.00
IGL02279:Dgcr14 APN 16 17902911 missense possibly damaging 0.95
R0227:Dgcr14 UTSW 16 17902271 missense probably damaging 0.97
R0316:Dgcr14 UTSW 16 17910094 missense probably benign 0.06
R0669:Dgcr14 UTSW 16 17907555 missense probably damaging 1.00
R0880:Dgcr14 UTSW 16 17911187 missense probably damaging 0.96
R1230:Dgcr14 UTSW 16 17909950 missense probably benign 0.00
R1429:Dgcr14 UTSW 16 17902205 nonsense probably null
R1633:Dgcr14 UTSW 16 17909967 missense probably benign 0.03
R1891:Dgcr14 UTSW 16 17907780 nonsense probably null
R2035:Dgcr14 UTSW 16 17910086 critical splice donor site probably null
R2267:Dgcr14 UTSW 16 17909995 missense probably damaging 1.00
R7126:Dgcr14 UTSW 16 17911290 missense unknown
R8479:Dgcr14 UTSW 16 17910941 splice site probably null
Z1176:Dgcr14 UTSW 16 17902310 missense possibly damaging 0.85
Z1177:Dgcr14 UTSW 16 17909922 missense probably benign
Predicted Primers PCR Primer
(F):5'- AACTGGATGCCCACTTCTGC -3'
(R):5'- CAGTGACATCATTGGAGCGC -3'

Sequencing Primer
(F):5'- GCATTGTTTTCTTGGTTCTCAATGC -3'
(R):5'- GCGCCGGCTTTGTTACAAAAATAC -3'
Posted On2019-11-26