Incidental Mutation 'R7804:Dtna'
ID 600697
Institutional Source Beutler Lab
Gene Symbol Dtna
Ensembl Gene ENSMUSG00000024302
Gene Name dystrobrevin alpha
Synonyms a-DB-1, A0, alpha-dystrobrevin, 2210407P21Rik, 87K protein, Dtn, adbn
MMRRC Submission 045859-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.207) question?
Stock # R7804 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 23548192-23792772 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 23728666 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 287 (K287R)
Ref Sequence ENSEMBL: ENSMUSP00000152288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047954] [ENSMUST00000115832] [ENSMUST00000220904] [ENSMUST00000221880]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000047954
AA Change: K287R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000037475
Gene: ENSMUSG00000024302
AA Change: K287R

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 4.9e-43 PFAM
Pfam:EF-hand_3 144 232 7.8e-38 PFAM
ZnF_ZZ 237 282 1.29e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115832
AA Change: K287R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111498
Gene: ENSMUSG00000024302
AA Change: K287R

DomainStartEndE-ValueType
Pfam:EF-hand_2 16 140 1.7e-37 PFAM
Pfam:EF-hand_3 144 232 1.6e-32 PFAM
ZnF_ZZ 237 282 1.29e-17 SMART
SCOP:d1eq1a_ 361 494 5e-3 SMART
low complexity region 499 514 N/A INTRINSIC
coiled coil region 650 677 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000220904
AA Change: K287R

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000221880
AA Change: K287R

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.0751 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 95% (55/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the dystrobrevin subfamily of the dystrophin family. This protein is a component of the dystrophin-associated protein complex (DPC), which consists of dystrophin and several integral and peripheral membrane proteins, including dystroglycans, sarcoglycans, syntrophins and alpha- and beta-dystrobrevin. The DPC localizes to the sarcolemma and its disruption is associated with various forms of muscular dystrophy. Mutations in this gene are associated with left ventricular noncompaction with congenital heart defects. Multiple alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous targeted mutants exhibit skeletal and cardiac myopathies. Neuromuscular junctions appear to form normally, but their postnatal maturation is compromised. Dtna mutations do not increase the severity of Dmd or Utrn mutants whose products are also part of the dystrophin-glycoprotein complex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933415A04Rik GTGTGTATGTGT GTGTGT 11: 43,478,241 (GRCm39) probably benign Het
Ago4 A T 4: 126,406,423 (GRCm39) C296S probably benign Het
Apbb1 A G 7: 105,215,807 (GRCm39) L401P probably damaging Het
Cacnb2 C A 2: 14,972,848 (GRCm39) P252T probably benign Het
Ctnna2 C T 6: 77,618,357 (GRCm39) V202I probably benign Het
Dapk1 A T 13: 60,873,153 (GRCm39) I352F probably benign Het
Dexi T C 16: 10,360,349 (GRCm39) D69G possibly damaging Het
Dlg5 T C 14: 24,215,388 (GRCm39) E645G possibly damaging Het
Dnah3 A G 7: 119,551,841 (GRCm39) I2826T probably damaging Het
Dnah3 A G 7: 119,610,235 (GRCm39) W1734R probably damaging Het
Elovl5 A G 9: 77,887,105 (GRCm39) probably null Het
Ess2 T A 16: 17,729,031 (GRCm39) I47F probably damaging Het
Fam222b C A 11: 78,044,979 (GRCm39) P180Q probably benign Het
Fat3 C T 9: 15,901,888 (GRCm39) V3046I probably benign Het
Fem1a A G 17: 56,565,068 (GRCm39) D387G probably damaging Het
Frmd5 A G 2: 121,422,225 (GRCm39) Y33H probably damaging Het
Gucy2g A T 19: 55,216,584 (GRCm39) L464H probably benign Het
Ints2 T C 11: 86,103,489 (GRCm39) E1189G possibly damaging Het
Itgb4 T C 11: 115,894,510 (GRCm39) V1355A probably damaging Het
Lepr A T 4: 101,639,783 (GRCm39) S750C probably damaging Het
Lingo1 T C 9: 56,526,798 (GRCm39) D603G probably benign Het
Map4k3 A C 17: 80,922,499 (GRCm39) V474G probably damaging Het
Myl4 T A 11: 104,475,787 (GRCm39) V167E probably damaging Het
Naa25 T C 5: 121,562,652 (GRCm39) V478A probably benign Het
Neurl4 T A 11: 69,796,700 (GRCm39) L487H probably benign Het
Nkx2-9 C T 12: 56,658,917 (GRCm39) R99H probably damaging Het
Or4c110 C G 2: 88,831,855 (GRCm39) R259P unknown Het
Or52x1 A T 7: 104,853,367 (GRCm39) M61K probably damaging Het
Or6c76 A G 10: 129,612,091 (GRCm39) I103V probably benign Het
Pcdhga9 A G 18: 37,871,132 (GRCm39) I320M probably damaging Het
Pi15 T A 1: 17,695,137 (GRCm39) C251* probably null Het
Pkhd1l1 A T 15: 44,460,534 (GRCm39) K4248* probably null Het
Prkg1 C T 19: 30,556,032 (GRCm39) V625I probably benign Het
Prkg1 G A 19: 30,602,170 (GRCm39) A362V possibly damaging Het
Prol1 C T 5: 88,476,264 (GRCm39) T218I unknown Het
Ptpro G A 6: 137,376,599 (GRCm39) probably null Het
Rev3l T A 10: 39,699,481 (GRCm39) I1326K probably benign Het
Shank1 C A 7: 43,962,308 (GRCm39) R60S unknown Het
Slc24a2 A G 4: 86,909,774 (GRCm39) V648A probably damaging Het
Slc35d3 T C 10: 19,725,116 (GRCm39) T247A probably damaging Het
Specc1 C T 11: 62,096,223 (GRCm39) T895I probably damaging Het
Spta1 A G 1: 174,023,471 (GRCm39) E626G possibly damaging Het
Syngr2 C A 11: 117,703,401 (GRCm39) S72R possibly damaging Het
Synj2 T A 17: 6,069,809 (GRCm39) L490Q unknown Het
Tbc1d9 T C 8: 83,963,341 (GRCm39) L351P possibly damaging Het
Tcof1 G C 18: 60,962,123 (GRCm39) A702G possibly damaging Het
Themis3 G A 17: 66,862,605 (GRCm39) T451I probably benign Het
Tia1 T C 6: 86,401,364 (GRCm39) S146P probably benign Het
Tpp2 T A 1: 44,022,441 (GRCm39) N946K probably benign Het
Tpr A T 1: 150,308,310 (GRCm39) R1688S probably damaging Het
Trav12-1 A G 14: 53,775,988 (GRCm39) Q47R possibly damaging Het
Ttll9 G A 2: 152,844,278 (GRCm39) probably null Het
Ttn G A 2: 76,537,585 (GRCm39) T34781M possibly damaging Het
V1ra8 A G 6: 90,180,298 (GRCm39) Y167C probably damaging Het
Vegfb T C 19: 6,963,707 (GRCm39) D84G probably damaging Het
Vmn2r14 A T 5: 109,368,324 (GRCm39) L223M probably benign Het
Wdr26 A G 1: 181,010,387 (GRCm39) I554T probably damaging Het
Other mutations in Dtna
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Dtna APN 18 23,730,545 (GRCm39) missense probably benign 0.22
IGL01620:Dtna APN 18 23,758,144 (GRCm39) missense probably damaging 1.00
IGL01705:Dtna APN 18 23,678,788 (GRCm39) missense probably damaging 1.00
IGL01914:Dtna APN 18 23,730,516 (GRCm39) missense possibly damaging 0.62
IGL02388:Dtna APN 18 23,730,571 (GRCm39) missense probably benign 0.00
IGL02427:Dtna APN 18 23,784,595 (GRCm39) missense possibly damaging 0.95
IGL03074:Dtna APN 18 23,735,662 (GRCm39) missense possibly damaging 0.74
R0041:Dtna UTSW 18 23,779,932 (GRCm39) unclassified probably benign
R0041:Dtna UTSW 18 23,779,932 (GRCm39) unclassified probably benign
R0078:Dtna UTSW 18 23,754,499 (GRCm39) missense probably damaging 1.00
R0390:Dtna UTSW 18 23,730,558 (GRCm39) missense probably damaging 1.00
R1808:Dtna UTSW 18 23,702,697 (GRCm39) missense probably damaging 1.00
R1872:Dtna UTSW 18 23,730,617 (GRCm39) critical splice donor site probably null
R2095:Dtna UTSW 18 23,702,805 (GRCm39) missense probably damaging 1.00
R2216:Dtna UTSW 18 23,702,622 (GRCm39) missense probably damaging 1.00
R2295:Dtna UTSW 18 23,764,469 (GRCm39) missense probably damaging 1.00
R2402:Dtna UTSW 18 23,728,535 (GRCm39) nonsense probably null
R2846:Dtna UTSW 18 23,784,560 (GRCm39) splice site probably null
R3836:Dtna UTSW 18 23,758,159 (GRCm39) missense probably damaging 1.00
R4764:Dtna UTSW 18 23,668,206 (GRCm39) splice site probably null
R4893:Dtna UTSW 18 23,702,724 (GRCm39) missense probably damaging 0.99
R5194:Dtna UTSW 18 23,723,302 (GRCm39) nonsense probably null
R5373:Dtna UTSW 18 23,784,670 (GRCm39) missense probably damaging 1.00
R5374:Dtna UTSW 18 23,784,670 (GRCm39) missense probably damaging 1.00
R5526:Dtna UTSW 18 23,779,287 (GRCm39) missense probably damaging 0.99
R5755:Dtna UTSW 18 23,754,520 (GRCm39) missense probably benign
R5769:Dtna UTSW 18 23,784,611 (GRCm39) missense probably benign 0.27
R6062:Dtna UTSW 18 23,755,113 (GRCm39) missense possibly damaging 0.87
R6413:Dtna UTSW 18 23,755,071 (GRCm39) missense probably damaging 1.00
R6876:Dtna UTSW 18 23,744,167 (GRCm39) missense probably benign 0.00
R7103:Dtna UTSW 18 23,786,436 (GRCm39) critical splice donor site probably null
R7711:Dtna UTSW 18 23,758,253 (GRCm39) critical splice donor site probably null
R8156:Dtna UTSW 18 23,723,388 (GRCm39) nonsense probably null
R8437:Dtna UTSW 18 23,723,398 (GRCm39) nonsense probably null
R8786:Dtna UTSW 18 23,716,190 (GRCm39) missense probably benign 0.10
R9038:Dtna UTSW 18 23,743,553 (GRCm39) missense probably benign
R9268:Dtna UTSW 18 23,702,643 (GRCm39) missense possibly damaging 0.93
R9416:Dtna UTSW 18 23,780,112 (GRCm39) critical splice donor site probably null
R9578:Dtna UTSW 18 23,728,612 (GRCm39) missense probably damaging 0.98
R9605:Dtna UTSW 18 23,764,454 (GRCm39) missense probably damaging 1.00
R9638:Dtna UTSW 18 23,744,122 (GRCm39) missense probably benign
X0063:Dtna UTSW 18 23,776,225 (GRCm39) missense probably damaging 0.98
X0066:Dtna UTSW 18 23,726,038 (GRCm39) missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- TCTGAAATCAGCAGAGCACAG -3'
(R):5'- AGTTAAGTTTGCCCTCATTATCTGC -3'

Sequencing Primer
(F):5'- GCACAGAGCTGAAAAATTGAATTC -3'
(R):5'- TAAGAGCAAGGTTCTTCCATGGCC -3'
Posted On 2019-11-26