Incidental Mutation 'R7804:Vegfb'
ID600700
Institutional Source Beutler Lab
Gene Symbol Vegfb
Ensembl Gene ENSMUSG00000024962
Gene Namevascular endothelial growth factor B
SynonymsVrf, VEGF-B
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7804 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location6982473-6987651 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6986339 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 84 (D84G)
Ref Sequence ENSEMBL: ENSMUSP00000025914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025914] [ENSMUST00000025915] [ENSMUST00000130048] [ENSMUST00000179118]
Predicted Effect probably damaging
Transcript: ENSMUST00000025914
AA Change: D84G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025914
Gene: ENSMUSG00000024962
AA Change: D84G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PDGF 45 126 1.11e-44 SMART
low complexity region 182 207 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000025915
SMART Domains Protein: ENSMUSP00000025915
Gene: ENSMUSG00000024963

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
DnaJ 36 94 9.97e-23 SMART
transmembrane domain 160 179 N/A INTRINSIC
low complexity region 205 227 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130048
AA Change: D84G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120860
Gene: ENSMUSG00000024962
AA Change: D84G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PDGF 45 126 1.11e-44 SMART
Pfam:VEGF_C 134 188 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179118
SMART Domains Protein: ENSMUSP00000136062
Gene: ENSMUSG00000024963

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
DnaJ 36 94 9.97e-23 SMART
transmembrane domain 159 178 N/A INTRINSIC
low complexity region 204 226 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 95% (55/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PDGF (platelet-derived growth factor)/VEGF (vascular endothelial growth factor) family. The VEGF family members regulate the formation of blood vessels and are involved in endothelial cell physiology. This member is a ligand for VEGFR-1 (vascular endothelial growth factor receptor 1) and NRP-1 (neuropilin-1). Studies in mice showed that this gene was co-expressed with nuclear-encoded mitochondrial genes and the encoded protein specifically controlled endothelial uptake of fatty acids. Alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for one or more disruptions in this gene display defective cardiac morphology and physiology, sensitivity to induced neurodegeneration, increased weight and brown adipose whitening. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933415A04Rik GTGTGTATGTGT GTGTGT 11: 43,587,414 probably benign Het
Ago4 A T 4: 126,512,630 C296S probably benign Het
Apbb1 A G 7: 105,566,600 L401P probably damaging Het
Cacnb2 C A 2: 14,968,037 P252T probably benign Het
Ctnna2 C T 6: 77,641,374 V202I probably benign Het
Dapk1 A T 13: 60,725,339 I352F probably benign Het
Dexi T C 16: 10,542,485 D69G possibly damaging Het
Dgcr14 T A 16: 17,911,167 I47F probably damaging Het
Dlg5 T C 14: 24,165,320 E645G possibly damaging Het
Dnah3 A G 7: 119,952,618 I2826T probably damaging Het
Dnah3 A G 7: 120,011,012 W1734R probably damaging Het
Dtna A G 18: 23,595,609 K287R probably damaging Het
Elovl5 A G 9: 77,979,823 probably null Het
Fam222b C A 11: 78,154,153 P180Q probably benign Het
Fat3 C T 9: 15,990,592 V3046I probably benign Het
Fem1a A G 17: 56,258,068 D387G probably damaging Het
Frmd5 A G 2: 121,591,744 Y33H probably damaging Het
Gucy2g A T 19: 55,228,152 L464H probably benign Het
Ints2 T C 11: 86,212,663 E1189G possibly damaging Het
Itgb4 T C 11: 116,003,684 V1355A probably damaging Het
Lepr A T 4: 101,782,586 S750C probably damaging Het
Lingo1 T C 9: 56,619,514 D603G probably benign Het
Map4k3 A C 17: 80,615,070 V474G probably damaging Het
Myl4 T A 11: 104,584,961 V167E probably damaging Het
Naa25 T C 5: 121,424,589 V478A probably benign Het
Neurl4 T A 11: 69,905,874 L487H probably benign Het
Nkx2-9 C T 12: 56,612,132 R99H probably damaging Het
Olfr1215 C G 2: 89,001,511 R259P unknown Het
Olfr686 A T 7: 105,204,160 M61K probably damaging Het
Olfr809 A G 10: 129,776,222 I103V probably benign Het
Pcdhga9 A G 18: 37,738,079 I320M probably damaging Het
Pi15 T A 1: 17,624,913 C251* probably null Het
Pkhd1l1 A T 15: 44,597,138 K4248* probably null Het
Prkg1 C T 19: 30,578,632 V625I probably benign Het
Prkg1 G A 19: 30,624,770 A362V possibly damaging Het
Prol1 C T 5: 88,328,405 T218I unknown Het
Ptpro G A 6: 137,399,601 probably null Het
Rev3l T A 10: 39,823,485 I1326K probably benign Het
Shank1 C A 7: 44,312,884 R60S unknown Het
Slc24a2 A G 4: 86,991,537 V648A probably damaging Het
Slc35d3 T C 10: 19,849,370 T247A probably damaging Het
Specc1 C T 11: 62,205,397 T895I probably damaging Het
Spta1 A G 1: 174,195,905 E626G possibly damaging Het
Syngr2 C A 11: 117,812,575 S72R possibly damaging Het
Synj2 T A 17: 6,019,534 L490Q unknown Het
Tbc1d9 T C 8: 83,236,712 L351P possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Themis3 G A 17: 66,555,610 T451I probably benign Het
Tia1 T C 6: 86,424,382 S146P probably benign Het
Tpp2 T A 1: 43,983,281 N946K probably benign Het
Tpr A T 1: 150,432,559 R1688S probably damaging Het
Trav12-1 A G 14: 53,538,531 Q47R possibly damaging Het
Ttll9 G A 2: 153,002,358 probably null Het
Ttn G A 2: 76,707,241 T34781M possibly damaging Het
V1ra8 A G 6: 90,203,316 Y167C probably damaging Het
Vmn2r14 A T 5: 109,220,458 L223M probably benign Het
Wdr26 A G 1: 181,182,822 I554T probably damaging Het
Other mutations in Vegfb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Vegfb APN 19 6986478 missense probably damaging 1.00
IGL02365:Vegfb APN 19 6985487 missense probably benign 0.19
IGL02431:Vegfb APN 19 6986018 splice site probably null
R2040:Vegfb UTSW 19 6986039 missense possibly damaging 0.93
R2312:Vegfb UTSW 19 6985427 missense possibly damaging 0.63
R3777:Vegfb UTSW 19 6987399 unclassified probably benign
R4152:Vegfb UTSW 19 6986078 missense probably damaging 1.00
R4154:Vegfb UTSW 19 6986078 missense probably damaging 1.00
R5635:Vegfb UTSW 19 6982846 makesense probably null
R8348:Vegfb UTSW 19 6985488 missense probably benign 0.01
R8673:Vegfb UTSW 19 6985444 missense unknown
Predicted Primers PCR Primer
(F):5'- TCTGTGCTCAGGAGAACGAG -3'
(R):5'- AACTTAATCCATCTGGGTCTGC -3'

Sequencing Primer
(F):5'- CAGAGGAAGGGGATACTAGATAGGC -3'
(R):5'- CCCACAGTGGTGCCATGGATAG -3'
Posted On2019-11-26