Mutagenetix > Incidental Mutation

Incidental Mutation 'R7804:Prkg1'

600702

Institutional Source

Beutler Lab

Gene Symbol

Prkg1

Ensembl Gene

ENSMUSG00000052920

Gene Name

protein kinase, cGMP-dependent, type I

Synonyms

Prkgr1b, Prkg1b

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.487) question?

Stock #

R7804 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

30567551-31765033 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 30624770 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 362 (A362V)

Ref Sequence

ENSEMBL: ENSMUSP00000073268 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065067] [ENSMUST00000073581]

AlphaFold

P0C605

Predicted Effect

probably benign
Transcript: ENSMUST00000065067
AA Change: A347V

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000067576
Gene: ENSMUSG00000052920
AA Change: A347V

Domain	Start	End	E-Value	Type
coiled coil region	5	49	N/A	INTRINSIC
cNMP	103	216	6.37e-27	SMART
cNMP	221	343	1.23e-33	SMART
S_TKc	360	619	5.25e-91	SMART
S_TK_X	620	671	1.55e-10	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000073581
AA Change: A362V

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000073268
Gene: ENSMUSG00000052920
AA Change: A362V

Domain	Start	End	E-Value	Type
coiled coil region	10	62	N/A	INTRINSIC
cNMP	118	231	6.37e-27	SMART
cNMP	236	358	1.23e-33	SMART
S_TKc	375	634	5.25e-91	SMART
S_TK_X	635	686	1.55e-10	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

95% (55/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammals have three different isoforms of cyclic GMP-dependent protein kinase (Ialpha, Ibeta, and II). These PRKG isoforms act as key mediators of the nitric oxide/cGMP signaling pathway and are important components of many signal transduction processes in diverse cell types. This PRKG1 gene on human chromosome 10 encodes the soluble Ialpha and Ibeta isoforms of PRKG by alternative transcript splicing. A separate gene on human chromosome 4, PRKG2, encodes the membrane-bound PRKG isoform II. The PRKG1 proteins play a central role in regulating cardiovascular and neuronal functions in addition to relaxing smooth muscle tone, preventing platelet aggregation, and modulating cell growth. This gene is most strongly expressed in all types of smooth muscle, platelets, cerebellar Purkinje cells, hippocampal neurons, and the lateral amygdala. Isoforms Ialpha and Ibeta have identical cGMP-binding and catalytic domains but differ in their leucine/isoleucine zipper and autoinhibitory sequences and therefore differ in their dimerization substrates and kinase enzyme activity. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mutant mice exhibit abnormal smooth muscle function and penile erectile deficiency. Conditional disruption in the hippocampus results in impaired LTP. Mice homozygous for a transposon induced allele exhibit postnatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933415A04Rik	GTGTGTATGTGT	GTGTGT	11: 43,587,414		probably benign	Het
Ago4	A	T	4: 126,512,630	C296S	probably benign	Het
Apbb1	A	G	7: 105,566,600	L401P	probably damaging	Het
Cacnb2	C	A	2: 14,968,037	P252T	probably benign	Het
Ctnna2	C	T	6: 77,641,374	V202I	probably benign	Het
Dapk1	A	T	13: 60,725,339	I352F	probably benign	Het
Dexi	T	C	16: 10,542,485	D69G	possibly damaging	Het
Dgcr14	T	A	16: 17,911,167	I47F	probably damaging	Het
Dlg5	T	C	14: 24,165,320	E645G	possibly damaging	Het
Dnah3	A	G	7: 119,952,618	I2826T	probably damaging	Het
Dnah3	A	G	7: 120,011,012	W1734R	probably damaging	Het
Dtna	A	G	18: 23,595,609	K287R	probably damaging	Het
Elovl5	A	G	9: 77,979,823		probably null	Het
Fam222b	C	A	11: 78,154,153	P180Q	probably benign	Het
Fat3	C	T	9: 15,990,592	V3046I	probably benign	Het
Fem1a	A	G	17: 56,258,068	D387G	probably damaging	Het
Frmd5	A	G	2: 121,591,744	Y33H	probably damaging	Het
Gucy2g	A	T	19: 55,228,152	L464H	probably benign	Het
Ints2	T	C	11: 86,212,663	E1189G	possibly damaging	Het
Itgb4	T	C	11: 116,003,684	V1355A	probably damaging	Het
Lepr	A	T	4: 101,782,586	S750C	probably damaging	Het
Lingo1	T	C	9: 56,619,514	D603G	probably benign	Het
Map4k3	A	C	17: 80,615,070	V474G	probably damaging	Het
Myl4	T	A	11: 104,584,961	V167E	probably damaging	Het
Naa25	T	C	5: 121,424,589	V478A	probably benign	Het
Neurl4	T	A	11: 69,905,874	L487H	probably benign	Het
Nkx2-9	C	T	12: 56,612,132	R99H	probably damaging	Het
Olfr1215	C	G	2: 89,001,511	R259P	unknown	Het
Olfr686	A	T	7: 105,204,160	M61K	probably damaging	Het
Olfr809	A	G	10: 129,776,222	I103V	probably benign	Het
Pcdhga9	A	G	18: 37,738,079	I320M	probably damaging	Het
Pi15	T	A	1: 17,624,913	C251*	probably null	Het
Pkhd1l1	A	T	15: 44,597,138	K4248*	probably null	Het
Prol1	C	T	5: 88,328,405	T218I	unknown	Het
Ptpro	G	A	6: 137,399,601		probably null	Het
Rev3l	T	A	10: 39,823,485	I1326K	probably benign	Het
Shank1	C	A	7: 44,312,884	R60S	unknown	Het
Slc24a2	A	G	4: 86,991,537	V648A	probably damaging	Het
Slc35d3	T	C	10: 19,849,370	T247A	probably damaging	Het
Specc1	C	T	11: 62,205,397	T895I	probably damaging	Het
Spta1	A	G	1: 174,195,905	E626G	possibly damaging	Het
Syngr2	C	A	11: 117,812,575	S72R	possibly damaging	Het
Synj2	T	A	17: 6,019,534	L490Q	unknown	Het
Tbc1d9	T	C	8: 83,236,712	L351P	possibly damaging	Het
Tcof1	G	C	18: 60,829,051	A702G	possibly damaging	Het
Themis3	G	A	17: 66,555,610	T451I	probably benign	Het
Tia1	T	C	6: 86,424,382	S146P	probably benign	Het
Tpp2	T	A	1: 43,983,281	N946K	probably benign	Het
Tpr	A	T	1: 150,432,559	R1688S	probably damaging	Het
Trav12-1	A	G	14: 53,538,531	Q47R	possibly damaging	Het
Ttll9	G	A	2: 153,002,358		probably null	Het
Ttn	G	A	2: 76,707,241	T34781M	possibly damaging	Het
V1ra8	A	G	6: 90,203,316	Y167C	probably damaging	Het
Vegfb	T	C	19: 6,986,339	D84G	probably damaging	Het
Vmn2r14	A	T	5: 109,220,458	L223M	probably benign	Het
Wdr26	A	G	1: 181,182,822	I554T	probably damaging	Het

Other mutations in Prkg1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Prkg1	APN	19	31302340	missense	probably benign	0.02
IGL00481:Prkg1	APN	19	30571622	missense	probably benign	0.28
IGL00517:Prkg1	APN	19	30894668	missense	probably benign
IGL00782:Prkg1	APN	19	30578753	splice site	probably benign
IGL01070:Prkg1	APN	19	30569343	splice site	probably benign
IGL01106:Prkg1	APN	19	30585278	missense	probably benign	0.05
IGL01783:Prkg1	APN	19	30624689	missense	probably damaging	1.00
IGL02135:Prkg1	APN	19	30993076	missense	probably benign	0.13
IGL02492:Prkg1	APN	19	30724202	missense	probably damaging	1.00
IGL02543:Prkg1	APN	19	30624734	missense	possibly damaging	0.62
IGL02733:Prkg1	APN	19	31302301	missense	probably damaging	1.00
IGL03129:Prkg1	APN	19	30585281	nonsense	probably null
IGL03220:Prkg1	APN	19	30569237	utr 3 prime	probably benign
R0363:Prkg1	UTSW	19	31664196	missense	probably damaging	1.00
R0693:Prkg1	UTSW	19	30594978	missense	probably benign
R1099:Prkg1	UTSW	19	30571612	missense	probably benign
R1464:Prkg1	UTSW	19	30578870	missense	probably damaging	0.99
R1464:Prkg1	UTSW	19	30578870	missense	probably damaging	0.99
R1556:Prkg1	UTSW	19	30624743	missense	probably benign
R1738:Prkg1	UTSW	19	30786922	missense	possibly damaging	0.48
R1974:Prkg1	UTSW	19	31585695	missense	probably damaging	1.00
R2011:Prkg1	UTSW	19	31664142	missense	possibly damaging	0.94
R2207:Prkg1	UTSW	19	30578860	missense	probably damaging	1.00
R2270:Prkg1	UTSW	19	30578631	missense	probably benign	0.27
R3009:Prkg1	UTSW	19	31664112	missense	possibly damaging	0.74
R4078:Prkg1	UTSW	19	31585578	missense	probably damaging	1.00
R4355:Prkg1	UTSW	19	30569229	utr 3 prime	probably benign
R4652:Prkg1	UTSW	19	30595012	missense	probably damaging	1.00
R4669:Prkg1	UTSW	19	31664239	missense	probably damaging	0.98
R4684:Prkg1	UTSW	19	31664179	nonsense	probably null
R4789:Prkg1	UTSW	19	31585645	missense	probably damaging	0.97
R4826:Prkg1	UTSW	19	31764606	missense	possibly damaging	0.93
R4936:Prkg1	UTSW	19	30586375	missense	probably benign	0.37
R5625:Prkg1	UTSW	19	31764762	missense	possibly damaging	0.95
R5819:Prkg1	UTSW	19	31585672	missense	probably benign	0.02
R5855:Prkg1	UTSW	19	30894694	missense	possibly damaging	0.93
R5882:Prkg1	UTSW	19	31585697	missense	probably damaging	1.00
R5965:Prkg1	UTSW	19	30724156	splice site	probably null
R5968:Prkg1	UTSW	19	30592924	missense	probably damaging	1.00
R6310:Prkg1	UTSW	19	30569251	missense	probably damaging	1.00
R6433:Prkg1	UTSW	19	30781346	missense	probably benign	0.21
R6702:Prkg1	UTSW	19	30993084	missense	probably benign	0.00
R6750:Prkg1	UTSW	19	31764561	missense	probably benign	0.41
R6894:Prkg1	UTSW	19	30624774	nonsense	probably null
R7155:Prkg1	UTSW	19	31302301	missense	probably damaging	1.00
R7165:Prkg1	UTSW	19	30585199	missense	probably damaging	1.00
R7238:Prkg1	UTSW	19	30624690	missense	probably damaging	1.00
R7428:Prkg1	UTSW	19	30578835	missense	probably damaging	1.00
R7748:Prkg1	UTSW	19	30993091	missense	possibly damaging	0.90
R7804:Prkg1	UTSW	19	30578632	missense	probably benign	0.00
R7893:Prkg1	UTSW	19	30586367	missense	probably damaging	0.99
R8304:Prkg1	UTSW	19	30724184	missense	possibly damaging	0.75
R8497:Prkg1	UTSW	19	31302309	missense	probably damaging	1.00
R8676:Prkg1	UTSW	19	31764746	missense	probably damaging	0.98
R9318:Prkg1	UTSW	19	30571638	missense	probably benign	0.09
R9694:Prkg1	UTSW	19	30786971	missense	possibly damaging	0.84
X0011:Prkg1	UTSW	19	30993121	missense	probably damaging	1.00
Z1177:Prkg1	UTSW	19	31302373	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- ACAGTCTCAGACATGCCTGC -3'
(R):5'- CTGGGACCAAAAGATTATGTGTG -3'

Sequencing Primer
(F):5'- CTGCTTCTGATTAGAGCAATGATAG -3'
(R):5'- TATGTGTGTGAGAAAACGCAGATTC -3'

Posted On

2019-11-26