Incidental Mutation 'R7805:Erc1'
ID600724
Institutional Source Beutler Lab
Gene Symbol Erc1
Ensembl Gene ENSMUSG00000030172
Gene NameELKS/RAB6-interacting/CAST family member 1
SynonymsB430107L16Rik, Rab6ip2, 5033405M01Rik, RAB6IP2A, 9630025C19Rik, RAB6IP2B
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7805 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location119570796-119848167 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119713771 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 847 (E847G)
Ref Sequence ENSEMBL: ENSMUSP00000032279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032279] [ENSMUST00000183703] [ENSMUST00000183880] [ENSMUST00000183911] [ENSMUST00000184838] [ENSMUST00000184864] [ENSMUST00000185139] [ENSMUST00000185143]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032279
AA Change: E847G

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000032279
Gene: ENSMUSG00000030172
AA Change: E847G

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 466 1.8e-142 PFAM
Pfam:Cast 453 838 3.5e-163 PFAM
Pfam:Cast 833 986 8e-61 PFAM
Pfam:RBD-FIP 1072 1112 1.5e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000183703
AA Change: E847G

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139031
Gene: ENSMUSG00000030172
AA Change: E847G

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 986 6.9e-291 PFAM
Pfam:RBD-FIP 1072 1112 1.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183880
SMART Domains Protein: ENSMUSP00000138823
Gene: ENSMUSG00000030172

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 914 4.3e-296 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000183911
AA Change: E815G

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139118
Gene: ENSMUSG00000030172
AA Change: E815G

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 954 4.2e-293 PFAM
Pfam:RBD-FIP 1040 1080 8.5e-14 PFAM
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000184838
SMART Domains Protein: ENSMUSP00000139030
Gene: ENSMUSG00000030172

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 942 3.5e-291 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000184864
AA Change: E843G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000139256
Gene: ENSMUSG00000030172
AA Change: E843G

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 982 2e-288 PFAM
Pfam:RBD-FIP 1068 1108 8.7e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000185139
AA Change: E819G

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139152
Gene: ENSMUSG00000030172
AA Change: E819G

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 958 3.6e-295 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000185143
AA Change: E547G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138989
Gene: ENSMUSG00000030172
AA Change: E547G

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 224 1.7e-28 PFAM
Pfam:Cast 222 686 8e-145 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of RIM-binding proteins. RIMs are active zone proteins that regulate neurotransmitter release. This gene has been found fused to the receptor-type tyrosine kinase gene RET by gene rearrangement due to the translocation t(10;12)(q11;p13) in thyroid papillary carcinoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for null mutations in this gene display embryonic lethality. Mice heterozygous for a gene trap null allele exhibit increased sensitivity to ionizing radiation-induced lethality, with males being more affected than females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik G T 4: 35,194,170 H372Q Het
Abca3 G A 17: 24,405,154 probably null Het
Aida A G 1: 183,304,698 K44R probably damaging Het
Ano5 G A 7: 51,537,800 V79M probably damaging Het
Armc9 G A 1: 86,196,319 G405D probably damaging Het
Baat T A 4: 49,490,327 R252S probably benign Het
Camkk2 G T 5: 122,742,212 T447K possibly damaging Het
Car2 A G 3: 14,900,070 I255V probably benign Het
Cdhr1 A T 14: 37,081,545 S525T probably benign Het
Col24a1 T C 3: 145,314,140 Y91H probably benign Het
Cryba1 C A 11: 77,722,608 probably null Het
Csmd2 G A 4: 128,419,573 E1348K Het
Dcst1 A G 3: 89,352,761 L592P probably damaging Het
Ddx17 A G 15: 79,537,522 I334T probably damaging Het
Dspp A T 5: 104,175,393 N134I probably damaging Het
Eif4g3 T C 4: 138,146,354 V535A probably benign Het
Fancc A G 13: 63,360,242 S160P possibly damaging Het
Fndc9 C T 11: 46,238,311 A219V probably damaging Het
Ifitm1 G A 7: 140,968,369 W38* probably null Het
Iqch A G 9: 63,421,720 probably null Het
Krt9 T C 11: 100,192,696 R170G possibly damaging Het
Lama4 T C 10: 39,026,751 probably null Het
Lrrc18 A G 14: 33,009,016 K171E probably damaging Het
Magi1 A G 6: 93,682,946 S1007P probably benign Het
Muc16 T A 9: 18,638,493 L5501F possibly damaging Het
Nrxn2 A G 19: 6,531,706 N1557S probably benign Het
Olfr1002 A T 2: 85,647,450 Y290* probably null Het
Ovgp1 A G 3: 105,986,794 T628A unknown Het
Pld5 A T 1: 176,044,914 L219Q probably damaging Het
Rabggta G A 14: 55,719,512 T273I probably benign Het
Rnf208 A G 2: 25,243,900 D202G probably damaging Het
Sacs A G 14: 61,203,591 N1029D not run Het
Sema6b T A 17: 56,131,555 I114F probably damaging Het
Sgpp1 A G 12: 75,722,677 I239T probably damaging Het
Slc12a3 A G 8: 94,344,887 N638S probably damaging Het
Slc39a11 T C 11: 113,591,955 probably null Het
Smc3 T C 19: 53,640,959 S948P probably benign Het
Snx24 T A 18: 53,389,551 H159Q probably benign Het
Sycp2 G T 2: 178,380,858 N493K probably damaging Het
Tiam2 A G 17: 3,509,410 D1242G probably damaging Het
Triobp G T 15: 78,974,004 R1268S probably benign Het
Wdr12 T C 1: 60,097,594 probably benign Het
Xirp2 T A 2: 67,509,981 S855R probably benign Het
Zscan20 T A 4: 128,585,806 H964L probably damaging Het
Other mutations in Erc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Erc1 APN 6 119722303 missense probably damaging 0.96
IGL01345:Erc1 APN 6 119761263 nonsense probably null
IGL01370:Erc1 APN 6 119824465 missense probably damaging 1.00
IGL01443:Erc1 APN 6 119824471 missense probably damaging 1.00
IGL01550:Erc1 APN 6 119783394 missense probably damaging 0.96
IGL01798:Erc1 APN 6 119620337 missense possibly damaging 0.86
IGL02032:Erc1 APN 6 119630609 missense probably damaging 1.00
IGL02239:Erc1 APN 6 119773891 missense probably damaging 0.96
IGL02341:Erc1 APN 6 119594973 missense possibly damaging 0.92
couch UTSW 6 119743429 missense possibly damaging 0.81
divan UTSW 6 119753288 missense probably benign 0.27
PIT4498001:Erc1 UTSW 6 119779491 missense possibly damaging 0.92
R0149:Erc1 UTSW 6 119824830 missense probably damaging 1.00
R0277:Erc1 UTSW 6 119620328 missense probably damaging 1.00
R0323:Erc1 UTSW 6 119620328 missense probably damaging 1.00
R1053:Erc1 UTSW 6 119796926 missense probably damaging 1.00
R1252:Erc1 UTSW 6 119743392 missense possibly damaging 0.84
R1355:Erc1 UTSW 6 119743420 nonsense probably null
R1470:Erc1 UTSW 6 119694602 missense probably damaging 1.00
R1470:Erc1 UTSW 6 119694602 missense probably damaging 1.00
R1680:Erc1 UTSW 6 119575761 missense probably damaging 1.00
R1833:Erc1 UTSW 6 119743429 missense possibly damaging 0.81
R1954:Erc1 UTSW 6 119797305 missense probably damaging 1.00
R2037:Erc1 UTSW 6 119722255 missense possibly damaging 0.94
R2365:Erc1 UTSW 6 119575695 missense probably damaging 1.00
R3751:Erc1 UTSW 6 119824960 missense probably damaging 0.99
R4473:Erc1 UTSW 6 119848456 splice site probably null
R4778:Erc1 UTSW 6 119797337 splice site probably null
R4897:Erc1 UTSW 6 119777986 critical splice donor site probably null
R5260:Erc1 UTSW 6 119761159 missense probably damaging 1.00
R5382:Erc1 UTSW 6 119761272 missense probably benign 0.02
R5405:Erc1 UTSW 6 119824944 missense probably damaging 1.00
R5801:Erc1 UTSW 6 119773822 missense probably damaging 0.99
R6341:Erc1 UTSW 6 119777998 missense possibly damaging 0.94
R6588:Erc1 UTSW 6 119575726 missense possibly damaging 0.92
R7441:Erc1 UTSW 6 119824951 missense possibly damaging 0.86
R7486:Erc1 UTSW 6 119594946 nonsense probably null
R7532:Erc1 UTSW 6 119779631 missense probably benign 0.02
R7575:Erc1 UTSW 6 119824760 missense possibly damaging 0.93
R7576:Erc1 UTSW 6 119824760 missense possibly damaging 0.93
R7705:Erc1 UTSW 6 119824603 missense probably benign 0.33
R7740:Erc1 UTSW 6 119761188 missense probably benign 0.02
R7789:Erc1 UTSW 6 119773709 nonsense probably null
R7833:Erc1 UTSW 6 119824486 nonsense probably null
R8039:Erc1 UTSW 6 119773665 nonsense probably null
R8229:Erc1 UTSW 6 119753288 missense probably benign 0.27
R8363:Erc1 UTSW 6 119753299 missense probably benign 0.00
R8794:Erc1 UTSW 6 119630655 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGTCACCTGAAACTGCACTG -3'
(R):5'- AAACCCATCATGTCTGCCTC -3'

Sequencing Primer
(F):5'- GAAACTGCACTGGCTTTACC -3'
(R):5'- GCTCTTAATAACAGACTTCAGCTTC -3'
Posted On2019-11-26