Incidental Mutation 'R7805:Muc16'
ID600728
Institutional Source Beutler Lab
Gene Symbol Muc16
Ensembl Gene ENSMUSG00000109564
Gene Namemucin 16
Synonyms1110008I14Rik, LOC385009
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R7805 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location18495455-18674530 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18638493 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 5501 (L5501F)
Ref Sequence ENSEMBL: ENSMUSP00000147104 (fasta)
Predicted Effect possibly damaging
Transcript: ENSMUST00000208663
AA Change: L5501F

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik G T 4: 35,194,170 H372Q Het
Abca3 G A 17: 24,405,154 probably null Het
Aida A G 1: 183,304,698 K44R probably damaging Het
Ano5 G A 7: 51,537,800 V79M probably damaging Het
Armc9 G A 1: 86,196,319 G405D probably damaging Het
Baat T A 4: 49,490,327 R252S probably benign Het
Camkk2 G T 5: 122,742,212 T447K possibly damaging Het
Car2 A G 3: 14,900,070 I255V probably benign Het
Cdhr1 A T 14: 37,081,545 S525T probably benign Het
Col24a1 T C 3: 145,314,140 Y91H probably benign Het
Cryba1 C A 11: 77,722,608 probably null Het
Csmd2 G A 4: 128,419,573 E1348K Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,471,803 probably benign Het
Dcst1 A G 3: 89,352,761 L592P probably damaging Het
Ddx17 A G 15: 79,537,522 I334T probably damaging Het
Dspp A T 5: 104,175,393 N134I probably damaging Het
Eif4g3 T C 4: 138,146,354 V535A probably benign Het
Erc1 T C 6: 119,713,771 E847G possibly damaging Het
Fancc A G 13: 63,360,242 S160P possibly damaging Het
Fndc9 C T 11: 46,238,311 A219V probably damaging Het
Ifitm1 G A 7: 140,968,369 W38* probably null Het
Krt9 T C 11: 100,192,696 R170G possibly damaging Het
Lama4 T C 10: 39,026,751 probably null Het
Lrrc18 A G 14: 33,009,016 K171E probably damaging Het
Magi1 A G 6: 93,682,946 S1007P probably benign Het
Nrxn2 A G 19: 6,531,706 N1557S probably benign Het
Olfr1002 A T 2: 85,647,450 Y290* probably null Het
Ovgp1 A G 3: 105,986,794 T628A unknown Het
Pld5 A T 1: 176,044,914 L219Q probably damaging Het
Rabggta G A 14: 55,719,512 T273I probably benign Het
Rnf208 A G 2: 25,243,900 D202G probably damaging Het
Sacs A G 14: 61,203,591 N1029D not run Het
Sema6b T A 17: 56,131,555 I114F probably damaging Het
Sgpp1 A G 12: 75,722,677 I239T probably damaging Het
Slc12a3 A G 8: 94,344,887 N638S probably damaging Het
Smc3 T C 19: 53,640,959 S948P probably benign Het
Snx24 T A 18: 53,389,551 H159Q probably benign Het
Sycp2 G T 2: 178,380,858 N493K probably damaging Het
Tiam2 A G 17: 3,509,410 D1242G probably damaging Het
Triobp G T 15: 78,974,004 R1268S probably benign Het
Wdr12 T C 1: 60,097,594 probably benign Het
Xirp2 T A 2: 67,509,981 S855R probably benign Het
Zscan20 T A 4: 128,585,806 H964L probably damaging Het
Other mutations in Muc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Muc16 APN 9 18508507 missense possibly damaging 0.89
IGL01878:Muc16 APN 9 18495543 missense possibly damaging 0.90
IGL02394:Muc16 APN 9 18498700 missense probably damaging 0.99
IGL02553:Muc16 APN 9 18498553 critical splice donor site probably null
R0400:Muc16 UTSW 9 18510534 missense possibly damaging 0.74
R1620:Muc16 UTSW 9 18510477 missense possibly damaging 0.89
R1695:Muc16 UTSW 9 18497433 missense probably damaging 1.00
R3196:Muc16 UTSW 9 18497830 missense probably damaging 1.00
R5982:Muc16 UTSW 9 18647146 missense unknown
R5990:Muc16 UTSW 9 18659243 missense unknown
R6024:Muc16 UTSW 9 18646671 missense unknown
R6026:Muc16 UTSW 9 18659858 missense unknown
R6028:Muc16 UTSW 9 18657176 missense unknown
R6083:Muc16 UTSW 9 18657212 missense unknown
R6089:Muc16 UTSW 9 18643252 missense unknown
R6109:Muc16 UTSW 9 18655359 missense unknown
R6127:Muc16 UTSW 9 18657878 missense unknown
R6130:Muc16 UTSW 9 18590698 missense probably damaging 1.00
R6146:Muc16 UTSW 9 18497797 missense probably damaging 0.98
R6161:Muc16 UTSW 9 18647818 missense unknown
R6164:Muc16 UTSW 9 18558379 missense probably damaging 1.00
R6185:Muc16 UTSW 9 18654473 missense unknown
R6192:Muc16 UTSW 9 18658689 missense unknown
R6217:Muc16 UTSW 9 18655446 missense unknown
R6232:Muc16 UTSW 9 18656998 missense unknown
R6246:Muc16 UTSW 9 18577067 intron probably null
R6255:Muc16 UTSW 9 18655599 missense unknown
R6280:Muc16 UTSW 9 18579317 critical splice donor site probably null
R6286:Muc16 UTSW 9 18644389 missense unknown
R6287:Muc16 UTSW 9 18659034 missense unknown
R6307:Muc16 UTSW 9 18647588 missense unknown
R6310:Muc16 UTSW 9 18641950 missense probably benign 0.00
R6316:Muc16 UTSW 9 18641819 missense probably benign 0.01
R6335:Muc16 UTSW 9 18660708 missense unknown
R6345:Muc16 UTSW 9 18654926 missense unknown
R6349:Muc16 UTSW 9 18657329 missense unknown
R6366:Muc16 UTSW 9 18646044 missense unknown
R6393:Muc16 UTSW 9 18647399 nonsense probably null
R6440:Muc16 UTSW 9 18641359 missense probably benign 0.01
R6458:Muc16 UTSW 9 18641721 missense probably benign 0.01
R6460:Muc16 UTSW 9 18640516 missense probably benign 0.01
R6481:Muc16 UTSW 9 18550677 critical splice donor site probably null
R6539:Muc16 UTSW 9 18637325 missense probably benign 0.25
R6551:Muc16 UTSW 9 18562562 missense possibly damaging 0.95
R6596:Muc16 UTSW 9 18566715 missense probably benign 0.18
R6601:Muc16 UTSW 9 18637570 missense probably benign 0.10
R6602:Muc16 UTSW 9 18609476 intron probably null
R6615:Muc16 UTSW 9 18647188 missense unknown
R6625:Muc16 UTSW 9 18660278 missense unknown
R6668:Muc16 UTSW 9 18640385 missense probably benign 0.03
R6697:Muc16 UTSW 9 18641291 missense probably benign 0.01
R6710:Muc16 UTSW 9 18642070 missense possibly damaging 0.95
R6727:Muc16 UTSW 9 18566690 critical splice donor site probably null
R6789:Muc16 UTSW 9 18559986 missense probably benign 0.40
R6806:Muc16 UTSW 9 18537910 critical splice donor site probably null
R6874:Muc16 UTSW 9 18658769 nonsense probably null
R6894:Muc16 UTSW 9 18495576 missense possibly damaging 0.92
R6913:Muc16 UTSW 9 18642663 missense unknown
R6919:Muc16 UTSW 9 18660299 missense unknown
R6939:Muc16 UTSW 9 18638537 missense probably benign 0.04
R6953:Muc16 UTSW 9 18640529 missense probably benign 0.01
R6956:Muc16 UTSW 9 18645026 missense unknown
R6977:Muc16 UTSW 9 18645337 missense unknown
R6996:Muc16 UTSW 9 18645897 missense unknown
R7011:Muc16 UTSW 9 18637451 missense probably benign 0.26
R7011:Muc16 UTSW 9 18637543 missense probably benign 0.10
R7012:Muc16 UTSW 9 18495618 critical splice acceptor site probably null
R7014:Muc16 UTSW 9 18658236 missense unknown
R7021:Muc16 UTSW 9 18554919 missense unknown
R7021:Muc16 UTSW 9 18550831 splice site probably null
R7038:Muc16 UTSW 9 18620468 missense probably damaging 0.99
R7057:Muc16 UTSW 9 18646079 missense unknown
R7058:Muc16 UTSW 9 18639755 missense probably benign 0.10
R7066:Muc16 UTSW 9 18658021 missense unknown
R7067:Muc16 UTSW 9 18658251 missense unknown
R7070:Muc16 UTSW 9 18645923 nonsense probably null
R7074:Muc16 UTSW 9 18655650 missense unknown
R7085:Muc16 UTSW 9 18644849 missense unknown
R7088:Muc16 UTSW 9 18592680 missense probably damaging 0.99
R7107:Muc16 UTSW 9 18637298 missense probably benign 0.10
R7108:Muc16 UTSW 9 18655233 missense unknown
R7126:Muc16 UTSW 9 18641216 missense probably benign 0.01
R7128:Muc16 UTSW 9 18643004 missense unknown
R7145:Muc16 UTSW 9 18655580 missense unknown
R7179:Muc16 UTSW 9 18642008 missense probably benign 0.00
R7194:Muc16 UTSW 9 18674454 missense unknown
R7211:Muc16 UTSW 9 18498570 missense probably damaging 1.00
R7213:Muc16 UTSW 9 18641416 missense probably benign 0.01
R7217:Muc16 UTSW 9 18644076 nonsense probably null
R7221:Muc16 UTSW 9 18642199 missense probably benign 0.04
R7265:Muc16 UTSW 9 18656472 missense unknown
R7326:Muc16 UTSW 9 18585013 missense probably benign 0.03
R7359:Muc16 UTSW 9 18643020 missense unknown
R7387:Muc16 UTSW 9 18641720 missense probably benign 0.01
R7391:Muc16 UTSW 9 18639536 missense probably benign 0.04
R7398:Muc16 UTSW 9 18637742 missense possibly damaging 0.46
R7419:Muc16 UTSW 9 18641962 missense probably benign 0.01
R7431:Muc16 UTSW 9 18607993 missense
R7484:Muc16 UTSW 9 18646768 missense unknown
R7487:Muc16 UTSW 9 18584799 missense possibly damaging 0.93
R7497:Muc16 UTSW 9 18645089 missense unknown
R7515:Muc16 UTSW 9 18639662 missense probably benign 0.00
R7537:Muc16 UTSW 9 18638135 missense probably benign 0.06
R7538:Muc16 UTSW 9 18642131 missense probably benign 0.10
R7538:Muc16 UTSW 9 18655451 missense unknown
R7543:Muc16 UTSW 9 18644732 missense unknown
R7566:Muc16 UTSW 9 18638629 missense probably benign 0.00
R7581:Muc16 UTSW 9 18645614 missense unknown
R7594:Muc16 UTSW 9 18645062 missense unknown
R7629:Muc16 UTSW 9 18566785 missense possibly damaging 0.86
R7664:Muc16 UTSW 9 18607722 missense probably benign 0.08
R7666:Muc16 UTSW 9 18558427 missense probably damaging 1.00
R7703:Muc16 UTSW 9 18605282 missense
R7727:Muc16 UTSW 9 18660242 missense unknown
R7743:Muc16 UTSW 9 18657477 missense unknown
R7744:Muc16 UTSW 9 18585096 critical splice acceptor site probably null
R7761:Muc16 UTSW 9 18580574 missense probably damaging 1.00
R7769:Muc16 UTSW 9 18660507 missense unknown
R7827:Muc16 UTSW 9 18595223 missense possibly damaging 0.83
R7845:Muc16 UTSW 9 18640773 missense probably benign 0.01
R7849:Muc16 UTSW 9 18640505 missense probably benign 0.01
R7884:Muc16 UTSW 9 18642694 missense unknown
R7885:Muc16 UTSW 9 18639464 missense probably benign 0.10
R7886:Muc16 UTSW 9 18585982 missense probably benign 0.03
R7899:Muc16 UTSW 9 18640697 missense probably benign 0.01
R7904:Muc16 UTSW 9 18655650 missense unknown
R7928:Muc16 UTSW 9 18640773 missense probably benign 0.01
R7932:Muc16 UTSW 9 18640505 missense probably benign 0.01
R7948:Muc16 UTSW 9 18642490 missense not run
R7967:Muc16 UTSW 9 18642694 missense unknown
R7968:Muc16 UTSW 9 18639464 missense probably benign 0.10
R7969:Muc16 UTSW 9 18585982 missense probably benign 0.03
R7982:Muc16 UTSW 9 18640697 missense probably benign 0.01
R7987:Muc16 UTSW 9 18655650 missense unknown
R7998:Muc16 UTSW 9 18639892 missense not run
R8014:Muc16 UTSW 9 18654875 missense not run
R8033:Muc16 UTSW 9 18636606 missense not run
R8052:Muc16 UTSW 9 18659051 missense not run
R8058:Muc16 UTSW 9 18660002 nonsense probably null
Z1177:Muc16 UTSW 9 18537571 missense not run
Z1177:Muc16 UTSW 9 18657861 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGGCCCAGAATTGGTTTCC -3'
(R):5'- GAAAGCCATTCAGTGACTTCTACTC -3'

Sequencing Primer
(F):5'- AAGGCCCAGAATTGGTTTCCATTTC -3'
(R):5'- CATTCAGTGACTTCTACTCAGGATAC -3'
Posted On2019-11-26