Mutagenetix > Incidental Mutations

Incidental Mutation 'R7805:Muc16'

600728

Institutional Source

Beutler Lab

Gene Symbol

Muc16

Ensembl Gene

ENSMUSG00000109564

Gene Name

mucin 16

Synonyms

1110008I14Rik, LOC385009

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.127) question?

Stock #

R7805 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

18495455-18674530 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 18638493 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 5501 (L5501F)

Ref Sequence

ENSEMBL: ENSMUSP00000147104 (fasta)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000208663
AA Change: L5501F

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110043O21Rik	G	T	4: 35,194,170	H372Q		Het
Abca3	G	A	17: 24,405,154		probably null	Het
Aida	A	G	1: 183,304,698	K44R	probably damaging	Het
Ano5	G	A	7: 51,537,800	V79M	probably damaging	Het
Armc9	G	A	1: 86,196,319	G405D	probably damaging	Het
Baat	T	A	4: 49,490,327	R252S	probably benign	Het
Camkk2	G	T	5: 122,742,212	T447K	possibly damaging	Het
Car2	A	G	3: 14,900,070	I255V	probably benign	Het
Cdhr1	A	T	14: 37,081,545	S525T	probably benign	Het
Col24a1	T	C	3: 145,314,140	Y91H	probably benign	Het
Cryba1	C	A	11: 77,722,608		probably null	Het
Csmd2	G	A	4: 128,419,573	E1348K		Het
Ctif	CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC	CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC	18: 75,471,803		probably benign	Het
Dcst1	A	G	3: 89,352,761	L592P	probably damaging	Het
Ddx17	A	G	15: 79,537,522	I334T	probably damaging	Het
Dspp	A	T	5: 104,175,393	N134I	probably damaging	Het
Eif4g3	T	C	4: 138,146,354	V535A	probably benign	Het
Erc1	T	C	6: 119,713,771	E847G	possibly damaging	Het
Fancc	A	G	13: 63,360,242	S160P	possibly damaging	Het
Fndc9	C	T	11: 46,238,311	A219V	probably damaging	Het
Ifitm1	G	A	7: 140,968,369	W38*	probably null	Het
Krt9	T	C	11: 100,192,696	R170G	possibly damaging	Het
Lama4	T	C	10: 39,026,751		probably null	Het
Lrrc18	A	G	14: 33,009,016	K171E	probably damaging	Het
Magi1	A	G	6: 93,682,946	S1007P	probably benign	Het
Nrxn2	A	G	19: 6,531,706	N1557S	probably benign	Het
Olfr1002	A	T	2: 85,647,450	Y290*	probably null	Het
Ovgp1	A	G	3: 105,986,794	T628A	unknown	Het
Pld5	A	T	1: 176,044,914	L219Q	probably damaging	Het
Rabggta	G	A	14: 55,719,512	T273I	probably benign	Het
Rnf208	A	G	2: 25,243,900	D202G	probably damaging	Het
Sacs	A	G	14: 61,203,591	N1029D	not run	Het
Sema6b	T	A	17: 56,131,555	I114F	probably damaging	Het
Sgpp1	A	G	12: 75,722,677	I239T	probably damaging	Het
Slc12a3	A	G	8: 94,344,887	N638S	probably damaging	Het
Smc3	T	C	19: 53,640,959	S948P	probably benign	Het
Snx24	T	A	18: 53,389,551	H159Q	probably benign	Het
Sycp2	G	T	2: 178,380,858	N493K	probably damaging	Het
Tiam2	A	G	17: 3,509,410	D1242G	probably damaging	Het
Triobp	G	T	15: 78,974,004	R1268S	probably benign	Het
Wdr12	T	C	1: 60,097,594		probably benign	Het
Xirp2	T	A	2: 67,509,981	S855R	probably benign	Het
Zscan20	T	A	4: 128,585,806	H964L	probably damaging	Het

Other mutations in Muc16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01330:Muc16	APN	9	18508507	missense	possibly damaging	0.89
IGL01878:Muc16	APN	9	18495543	missense	possibly damaging	0.90
IGL02394:Muc16	APN	9	18498700	missense	probably damaging	0.99
IGL02553:Muc16	APN	9	18498553	critical splice donor site	probably null
R0400:Muc16	UTSW	9	18510534	missense	possibly damaging	0.74
R1620:Muc16	UTSW	9	18510477	missense	possibly damaging	0.89
R1695:Muc16	UTSW	9	18497433	missense	probably damaging	1.00
R3196:Muc16	UTSW	9	18497830	missense	probably damaging	1.00
R5982:Muc16	UTSW	9	18647146	missense	unknown
R5990:Muc16	UTSW	9	18659243	missense	unknown
R6024:Muc16	UTSW	9	18646671	missense	unknown
R6026:Muc16	UTSW	9	18659858	missense	unknown
R6028:Muc16	UTSW	9	18657176	missense	unknown
R6083:Muc16	UTSW	9	18657212	missense	unknown
R6089:Muc16	UTSW	9	18643252	missense	unknown
R6109:Muc16	UTSW	9	18655359	missense	unknown
R6127:Muc16	UTSW	9	18657878	missense	unknown
R6130:Muc16	UTSW	9	18590698	missense	probably damaging	1.00
R6146:Muc16	UTSW	9	18497797	missense	probably damaging	0.98
R6161:Muc16	UTSW	9	18647818	missense	unknown
R6164:Muc16	UTSW	9	18558379	missense	probably damaging	1.00
R6185:Muc16	UTSW	9	18654473	missense	unknown
R6192:Muc16	UTSW	9	18658689	missense	unknown
R6217:Muc16	UTSW	9	18655446	missense	unknown
R6232:Muc16	UTSW	9	18656998	missense	unknown
R6246:Muc16	UTSW	9	18577067	intron	probably null
R6255:Muc16	UTSW	9	18655599	missense	unknown
R6280:Muc16	UTSW	9	18579317	critical splice donor site	probably null
R6286:Muc16	UTSW	9	18644389	missense	unknown
R6287:Muc16	UTSW	9	18659034	missense	unknown
R6307:Muc16	UTSW	9	18647588	missense	unknown
R6310:Muc16	UTSW	9	18641950	missense	probably benign	0.00
R6316:Muc16	UTSW	9	18641819	missense	probably benign	0.01
R6335:Muc16	UTSW	9	18660708	missense	unknown
R6345:Muc16	UTSW	9	18654926	missense	unknown
R6349:Muc16	UTSW	9	18657329	missense	unknown
R6366:Muc16	UTSW	9	18646044	missense	unknown
R6393:Muc16	UTSW	9	18647399	nonsense	probably null
R6440:Muc16	UTSW	9	18641359	missense	probably benign	0.01
R6458:Muc16	UTSW	9	18641721	missense	probably benign	0.01
R6460:Muc16	UTSW	9	18640516	missense	probably benign	0.01
R6481:Muc16	UTSW	9	18550677	critical splice donor site	probably null
R6539:Muc16	UTSW	9	18637325	missense	probably benign	0.25
R6551:Muc16	UTSW	9	18562562	missense	possibly damaging	0.95
R6596:Muc16	UTSW	9	18566715	missense	probably benign	0.18
R6601:Muc16	UTSW	9	18637570	missense	probably benign	0.10
R6602:Muc16	UTSW	9	18609476	intron	probably null
R6615:Muc16	UTSW	9	18647188	missense	unknown
R6625:Muc16	UTSW	9	18660278	missense	unknown
R6668:Muc16	UTSW	9	18640385	missense	probably benign	0.03
R6697:Muc16	UTSW	9	18641291	missense	probably benign	0.01
R6710:Muc16	UTSW	9	18642070	missense	possibly damaging	0.95
R6727:Muc16	UTSW	9	18566690	critical splice donor site	probably null
R6789:Muc16	UTSW	9	18559986	missense	probably benign	0.40
R6806:Muc16	UTSW	9	18537910	critical splice donor site	probably null
R6874:Muc16	UTSW	9	18658769	nonsense	probably null
R6894:Muc16	UTSW	9	18495576	missense	possibly damaging	0.92
R6913:Muc16	UTSW	9	18642663	missense	unknown
R6919:Muc16	UTSW	9	18660299	missense	unknown
R6939:Muc16	UTSW	9	18638537	missense	probably benign	0.04
R6953:Muc16	UTSW	9	18640529	missense	probably benign	0.01
R6956:Muc16	UTSW	9	18645026	missense	unknown
R6977:Muc16	UTSW	9	18645337	missense	unknown
R6996:Muc16	UTSW	9	18645897	missense	unknown
R7011:Muc16	UTSW	9	18637451	missense	probably benign	0.26
R7011:Muc16	UTSW	9	18637543	missense	probably benign	0.10
R7012:Muc16	UTSW	9	18495618	critical splice acceptor site	probably null
R7014:Muc16	UTSW	9	18658236	missense	unknown
R7021:Muc16	UTSW	9	18554919	missense	unknown
R7021:Muc16	UTSW	9	18550831	splice site	probably null
R7038:Muc16	UTSW	9	18620468	missense	probably damaging	0.99
R7057:Muc16	UTSW	9	18646079	missense	unknown
R7058:Muc16	UTSW	9	18639755	missense	probably benign	0.10
R7066:Muc16	UTSW	9	18658021	missense	unknown
R7067:Muc16	UTSW	9	18658251	missense	unknown
R7070:Muc16	UTSW	9	18645923	nonsense	probably null
R7074:Muc16	UTSW	9	18655650	missense	unknown
R7085:Muc16	UTSW	9	18644849	missense	unknown
R7088:Muc16	UTSW	9	18592680	missense	probably damaging	0.99
R7107:Muc16	UTSW	9	18637298	missense	probably benign	0.10
R7108:Muc16	UTSW	9	18655233	missense	unknown
R7126:Muc16	UTSW	9	18641216	missense	probably benign	0.01
R7128:Muc16	UTSW	9	18643004	missense	unknown
R7145:Muc16	UTSW	9	18655580	missense	unknown
R7179:Muc16	UTSW	9	18642008	missense	probably benign	0.00
R7194:Muc16	UTSW	9	18674454	missense	unknown
R7211:Muc16	UTSW	9	18498570	missense	probably damaging	1.00
R7213:Muc16	UTSW	9	18641416	missense	probably benign	0.01
R7217:Muc16	UTSW	9	18644076	nonsense	probably null
R7221:Muc16	UTSW	9	18642199	missense	probably benign	0.04
R7265:Muc16	UTSW	9	18656472	missense	unknown
R7326:Muc16	UTSW	9	18585013	missense	probably benign	0.03
R7359:Muc16	UTSW	9	18643020	missense	unknown
R7387:Muc16	UTSW	9	18641720	missense	probably benign	0.01
R7391:Muc16	UTSW	9	18639536	missense	probably benign	0.04
R7398:Muc16	UTSW	9	18637742	missense	possibly damaging	0.46
R7419:Muc16	UTSW	9	18641962	missense	probably benign	0.01
R7431:Muc16	UTSW	9	18607993	missense
R7484:Muc16	UTSW	9	18646768	missense	unknown
R7487:Muc16	UTSW	9	18584799	missense	possibly damaging	0.93
R7497:Muc16	UTSW	9	18645089	missense	unknown
R7515:Muc16	UTSW	9	18639662	missense	probably benign	0.00
R7537:Muc16	UTSW	9	18638135	missense	probably benign	0.06
R7538:Muc16	UTSW	9	18642131	missense	probably benign	0.10
R7538:Muc16	UTSW	9	18655451	missense	unknown
R7543:Muc16	UTSW	9	18644732	missense	unknown
R7566:Muc16	UTSW	9	18638629	missense	probably benign	0.00
R7581:Muc16	UTSW	9	18645614	missense	unknown
R7594:Muc16	UTSW	9	18645062	missense	unknown
R7629:Muc16	UTSW	9	18566785	missense	possibly damaging	0.86
R7664:Muc16	UTSW	9	18607722	missense	probably benign	0.08
R7666:Muc16	UTSW	9	18558427	missense	probably damaging	1.00
R7703:Muc16	UTSW	9	18605282	missense
R7727:Muc16	UTSW	9	18660242	missense	unknown
R7743:Muc16	UTSW	9	18657477	missense	unknown
R7744:Muc16	UTSW	9	18585096	critical splice acceptor site	probably null
R7761:Muc16	UTSW	9	18580574	missense	probably damaging	1.00
R7769:Muc16	UTSW	9	18660507	missense	unknown
R7827:Muc16	UTSW	9	18595223	missense	possibly damaging	0.83
R7845:Muc16	UTSW	9	18640773	missense	probably benign	0.01
R7849:Muc16	UTSW	9	18640505	missense	probably benign	0.01
R7884:Muc16	UTSW	9	18642694	missense	unknown
R7885:Muc16	UTSW	9	18639464	missense	probably benign	0.10
R7886:Muc16	UTSW	9	18585982	missense	probably benign	0.03
R7899:Muc16	UTSW	9	18640697	missense	probably benign	0.01
R7904:Muc16	UTSW	9	18655650	missense	unknown
R7928:Muc16	UTSW	9	18640773	missense	probably benign	0.01
R7932:Muc16	UTSW	9	18640505	missense	probably benign	0.01
R7948:Muc16	UTSW	9	18642490	missense	not run
R7967:Muc16	UTSW	9	18642694	missense	unknown
R7968:Muc16	UTSW	9	18639464	missense	probably benign	0.10
R7969:Muc16	UTSW	9	18585982	missense	probably benign	0.03
R7982:Muc16	UTSW	9	18640697	missense	probably benign	0.01
R7987:Muc16	UTSW	9	18655650	missense	unknown
R7998:Muc16	UTSW	9	18639892	missense	not run
R8014:Muc16	UTSW	9	18654875	missense	not run
R8033:Muc16	UTSW	9	18636606	missense	not run
R8052:Muc16	UTSW	9	18659051	missense	not run
R8058:Muc16	UTSW	9	18660002	nonsense	probably null
Z1177:Muc16	UTSW	9	18537571	missense	not run
Z1177:Muc16	UTSW	9	18657861	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AAGGCCCAGAATTGGTTTCC -3'
(R):5'- GAAAGCCATTCAGTGACTTCTACTC -3'

Sequencing Primer
(F):5'- AAGGCCCAGAATTGGTTTCCATTTC -3'
(R):5'- CATTCAGTGACTTCTACTCAGGATAC -3'

Posted On

2019-11-26