Incidental Mutation 'R7805:Rabggta'
ID600737
Institutional Source Beutler Lab
Gene Symbol Rabggta
Ensembl Gene ENSMUSG00000040472
Gene NameRab geranylgeranyl transferase, a subunit
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R7805 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location55715416-55722263 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 55719512 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 273 (T273I)
Ref Sequence ENSEMBL: ENSMUSP00000128668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062861] [ENSMUST00000163889] [ENSMUST00000169237] [ENSMUST00000227061]
Predicted Effect probably benign
Transcript: ENSMUST00000062861
AA Change: T3I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000061498
Gene: ENSMUSG00000040472
AA Change: T3I

DomainStartEndE-ValueType
Pfam:PPTA 47 77 2.9e-8 PFAM
Pfam:PPTA 91 121 2e-12 PFAM
Pfam:PPTA 127 156 7.6e-11 PFAM
Pfam:PPTA 162 192 3.8e-12 PFAM
Pfam:PPTA 210 240 7.8e-12 PFAM
Pfam:RabGGT_insert 243 346 5.3e-47 PFAM
LRR 462 485 1.62e0 SMART
LRR 507 531 1.03e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163889
AA Change: T273I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000128668
Gene: ENSMUSG00000040472
AA Change: T273I

DomainStartEndE-ValueType
Pfam:PPTA 47 77 2.9e-8 PFAM
Pfam:PPTA 91 121 2e-12 PFAM
Pfam:PPTA 127 156 7.6e-11 PFAM
Pfam:PPTA 162 192 3.8e-12 PFAM
Pfam:PPTA 210 240 7.8e-12 PFAM
Pfam:RabGGT_insert 243 346 5.3e-47 PFAM
LRR 462 485 1.62e0 SMART
LRR 507 531 1.03e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169237
AA Change: T273I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000133032
Gene: ENSMUSG00000040472
AA Change: T273I

DomainStartEndE-ValueType
Pfam:PPTA 92 119 3.6e-12 PFAM
Pfam:PPTA 128 154 1.2e-10 PFAM
Pfam:PPTA 163 190 2e-11 PFAM
Pfam:PPTA 211 238 9e-12 PFAM
Pfam:RabGGT_insert 244 346 1.9e-46 PFAM
LRR 462 485 1.62e0 SMART
LRR 507 531 1.03e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000227061
AA Change: T273I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (43/44)
MGI Phenotype PHENOTYPE: Homozygotes exhibit diluted pigmentation, a platelet defect resulting in prolonged bleeding, macrothrombocytopenia, impaired killing by cytotoxic T lymphocytes, high mortality, and poor breeding. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik G T 4: 35,194,170 H372Q Het
Abca3 G A 17: 24,405,154 probably null Het
Aida A G 1: 183,304,698 K44R probably damaging Het
Ano5 G A 7: 51,537,800 V79M probably damaging Het
Armc9 G A 1: 86,196,319 G405D probably damaging Het
Baat T A 4: 49,490,327 R252S probably benign Het
Camkk2 G T 5: 122,742,212 T447K possibly damaging Het
Car2 A G 3: 14,900,070 I255V probably benign Het
Cdhr1 A T 14: 37,081,545 S525T probably benign Het
Col24a1 T C 3: 145,314,140 Y91H probably benign Het
Cryba1 C A 11: 77,722,608 probably null Het
Csmd2 G A 4: 128,419,573 E1348K Het
Dcst1 A G 3: 89,352,761 L592P probably damaging Het
Ddx17 A G 15: 79,537,522 I334T probably damaging Het
Dspp A T 5: 104,175,393 N134I probably damaging Het
Eif4g3 T C 4: 138,146,354 V535A probably benign Het
Erc1 T C 6: 119,713,771 E847G possibly damaging Het
Fancc A G 13: 63,360,242 S160P possibly damaging Het
Fndc9 C T 11: 46,238,311 A219V probably damaging Het
Ifitm1 G A 7: 140,968,369 W38* probably null Het
Iqch A G 9: 63,421,720 probably null Het
Krt9 T C 11: 100,192,696 R170G possibly damaging Het
Lama4 T C 10: 39,026,751 probably null Het
Lrrc18 A G 14: 33,009,016 K171E probably damaging Het
Magi1 A G 6: 93,682,946 S1007P probably benign Het
Muc16 T A 9: 18,638,493 L5501F possibly damaging Het
Nrxn2 A G 19: 6,531,706 N1557S probably benign Het
Olfr1002 A T 2: 85,647,450 Y290* probably null Het
Ovgp1 A G 3: 105,986,794 T628A unknown Het
Pld5 A T 1: 176,044,914 L219Q probably damaging Het
Rnf208 A G 2: 25,243,900 D202G probably damaging Het
Sacs A G 14: 61,203,591 N1029D not run Het
Sema6b T A 17: 56,131,555 I114F probably damaging Het
Sgpp1 A G 12: 75,722,677 I239T probably damaging Het
Slc12a3 A G 8: 94,344,887 N638S probably damaging Het
Slc39a11 T C 11: 113,591,955 probably null Het
Smc3 T C 19: 53,640,959 S948P probably benign Het
Snx24 T A 18: 53,389,551 H159Q probably benign Het
Sycp2 G T 2: 178,380,858 N493K probably damaging Het
Tiam2 A G 17: 3,509,410 D1242G probably damaging Het
Triobp G T 15: 78,974,004 R1268S probably benign Het
Wdr12 T C 1: 60,097,594 probably benign Het
Xirp2 T A 2: 67,509,981 S855R probably benign Het
Zscan20 T A 4: 128,585,806 H964L probably damaging Het
Other mutations in Rabggta
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01876:Rabggta APN 14 55718671 missense probably damaging 0.98
IGL02263:Rabggta APN 14 55718961 splice site probably benign
IGL02293:Rabggta APN 14 55721696 missense probably benign 0.27
IGL02377:Rabggta APN 14 55718495 missense possibly damaging 0.66
IGL02901:Rabggta APN 14 55721681 missense probably benign 0.41
IGL03004:Rabggta APN 14 55719230 splice site probably benign
R0334:Rabggta UTSW 14 55720811 missense probably damaging 1.00
R1914:Rabggta UTSW 14 55721189 missense possibly damaging 0.73
R2926:Rabggta UTSW 14 55719290 missense probably benign 0.00
R4469:Rabggta UTSW 14 55716487 missense probably benign 0.00
R5584:Rabggta UTSW 14 55720832 missense probably benign
R6721:Rabggta UTSW 14 55717203 missense probably damaging 1.00
R6960:Rabggta UTSW 14 55721842 critical splice donor site probably null
R7169:Rabggta UTSW 14 55720901 missense probably damaging 0.99
R7447:Rabggta UTSW 14 55719316 missense probably null 0.11
R8038:Rabggta UTSW 14 55718930 missense probably benign 0.07
R8422:Rabggta UTSW 14 55718458 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- GAGCTAGAGCACTGGTCAAG -3'
(R):5'- ACATTTAAGGTAAACCGAGGCTG -3'

Sequencing Primer
(F):5'- TGGTCAAGGAAACATGCTACCTC -3'
(R):5'- AAGGTAAACCGAGGCTGTTTCTCTC -3'
Posted On2019-11-26