Incidental Mutation 'R7805:Snx24'
ID600744
Institutional Source Beutler Lab
Gene Symbol Snx24
Ensembl Gene ENSMUSG00000024535
Gene Namesorting nexing 24
Synonyms2810011K15Rik, 5730433I16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R7805 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location53245662-53390823 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 53389551 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 159 (H159Q)
Ref Sequence ENSEMBL: ENSMUSP00000025417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025417] [ENSMUST00000165032]
Predicted Effect probably benign
Transcript: ENSMUST00000025417
AA Change: H159Q

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000025417
Gene: ENSMUSG00000024535
AA Change: H159Q

DomainStartEndE-ValueType
PX 1 103 4.19e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165032
AA Change: H159Q

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000131423
Gene: ENSMUSG00000024535
AA Change: H159Q

DomainStartEndE-ValueType
PX 1 103 4.19e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik G T 4: 35,194,170 H372Q Het
Abca3 G A 17: 24,405,154 probably null Het
Aida A G 1: 183,304,698 K44R probably damaging Het
Ano5 G A 7: 51,537,800 V79M probably damaging Het
Armc9 G A 1: 86,196,319 G405D probably damaging Het
Baat T A 4: 49,490,327 R252S probably benign Het
Camkk2 G T 5: 122,742,212 T447K possibly damaging Het
Car2 A G 3: 14,900,070 I255V probably benign Het
Cdhr1 A T 14: 37,081,545 S525T probably benign Het
Col24a1 T C 3: 145,314,140 Y91H probably benign Het
Cryba1 C A 11: 77,722,608 probably null Het
Csmd2 G A 4: 128,419,573 E1348K Het
Dcst1 A G 3: 89,352,761 L592P probably damaging Het
Ddx17 A G 15: 79,537,522 I334T probably damaging Het
Dspp A T 5: 104,175,393 N134I probably damaging Het
Eif4g3 T C 4: 138,146,354 V535A probably benign Het
Erc1 T C 6: 119,713,771 E847G possibly damaging Het
Fancc A G 13: 63,360,242 S160P possibly damaging Het
Fndc9 C T 11: 46,238,311 A219V probably damaging Het
Ifitm1 G A 7: 140,968,369 W38* probably null Het
Iqch A G 9: 63,421,720 probably null Het
Krt9 T C 11: 100,192,696 R170G possibly damaging Het
Lama4 T C 10: 39,026,751 probably null Het
Lrrc18 A G 14: 33,009,016 K171E probably damaging Het
Magi1 A G 6: 93,682,946 S1007P probably benign Het
Muc16 T A 9: 18,638,493 L5501F possibly damaging Het
Nrxn2 A G 19: 6,531,706 N1557S probably benign Het
Olfr1002 A T 2: 85,647,450 Y290* probably null Het
Ovgp1 A G 3: 105,986,794 T628A unknown Het
Pld5 A T 1: 176,044,914 L219Q probably damaging Het
Rabggta G A 14: 55,719,512 T273I probably benign Het
Rnf208 A G 2: 25,243,900 D202G probably damaging Het
Sacs A G 14: 61,203,591 N1029D not run Het
Sema6b T A 17: 56,131,555 I114F probably damaging Het
Sgpp1 A G 12: 75,722,677 I239T probably damaging Het
Slc12a3 A G 8: 94,344,887 N638S probably damaging Het
Slc39a11 T C 11: 113,591,955 probably null Het
Smc3 T C 19: 53,640,959 S948P probably benign Het
Sycp2 G T 2: 178,380,858 N493K probably damaging Het
Tiam2 A G 17: 3,509,410 D1242G probably damaging Het
Triobp G T 15: 78,974,004 R1268S probably benign Het
Wdr12 T C 1: 60,097,594 probably benign Het
Xirp2 T A 2: 67,509,981 S855R probably benign Het
Zscan20 T A 4: 128,585,806 H964L probably damaging Het
Other mutations in Snx24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00731:Snx24 APN 18 53384609 splice site probably benign
IGL02471:Snx24 APN 18 53385169 splice site probably benign
IGL02704:Snx24 APN 18 53327437 missense probably benign
R1645:Snx24 UTSW 18 53389562 missense probably benign
R4900:Snx24 UTSW 18 53385223 nonsense probably null
R5307:Snx24 UTSW 18 53340211 nonsense probably null
R7039:Snx24 UTSW 18 53340235 critical splice donor site probably null
R7299:Snx24 UTSW 18 53340172 missense probably damaging 1.00
R7301:Snx24 UTSW 18 53340172 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGACACTGTGGCCTTGATC -3'
(R):5'- TCTAATAGAAATGTCCCTGCTCC -3'

Sequencing Primer
(F):5'- ACACTGTGGCCTTGATCTCTGAC -3'
(R):5'- TGTCCCTGCTCCAAAGGAAG -3'
Posted On2019-11-26