Incidental Mutation 'R7806:Ccdc180'
ID600762
Institutional Source Beutler Lab
Gene Symbol Ccdc180
Ensembl Gene ENSMUSG00000035539
Gene Namecoiled-coil domain containing 180
SynonymsE230008N13Rik, LOC381522
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7806 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location45890303-45950774 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 45912801 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 593 (K593N)
Ref Sequence ENSEMBL: ENSMUSP00000136714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178561]
Predicted Effect
SMART Domains Protein: ENSMUSP00000119784
Gene: ENSMUSG00000035539
AA Change: K585N

DomainStartEndE-ValueType
low complexity region 25 42 N/A INTRINSIC
coiled coil region 90 117 N/A INTRINSIC
Pfam:DUF4455 141 609 2e-189 PFAM
low complexity region 628 642 N/A INTRINSIC
low complexity region 658 675 N/A INTRINSIC
coiled coil region 710 780 N/A INTRINSIC
coiled coil region 945 979 N/A INTRINSIC
low complexity region 1100 1123 N/A INTRINSIC
Pfam:DUF4456 1169 1372 9.5e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151024
SMART Domains Protein: ENSMUSP00000122332
Gene: ENSMUSG00000035539

DomainStartEndE-ValueType
low complexity region 8 22 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
coiled coil region 90 160 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000178561
AA Change: K593N

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000136714
Gene: ENSMUSG00000035539
AA Change: K593N

DomainStartEndE-ValueType
low complexity region 32 49 N/A INTRINSIC
coiled coil region 98 125 N/A INTRINSIC
Pfam:DUF4455 148 616 7.3e-189 PFAM
low complexity region 635 649 N/A INTRINSIC
low complexity region 665 682 N/A INTRINSIC
coiled coil region 718 788 N/A INTRINSIC
coiled coil region 1121 1155 N/A INTRINSIC
low complexity region 1275 1298 N/A INTRINSIC
Pfam:DUF4456 1344 1547 2.2e-76 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (83/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a coiled-coil domain. Alternative splicing results in multiple transcript variants encoding different isoforms. A single nucleotide polymorphism (SNP) in this gene has been associated with increased susceptibility to Behcet's Disease (PMID: 19442274). [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik C A 8: 124,842,404 V144F probably benign Het
Aar2 T A 2: 156,551,111 I140N possibly damaging Het
Abca15 A G 7: 120,332,836 N104S probably damaging Het
Adam22 A T 5: 8,092,825 N803K probably damaging Het
Adk A G 14: 21,326,611 N26S Het
Ak9 A C 10: 41,433,084 probably null Het
Alpk2 T C 18: 65,349,416 D40G probably benign Het
Ankrd65 A T 4: 155,792,980 H316L probably benign Het
Cabp7 C T 11: 4,738,889 A194T probably damaging Het
Cd80 A G 16: 38,473,953 D66G probably benign Het
Cdh5 T C 8: 104,140,816 V575A probably damaging Het
Cep350 T C 1: 155,862,063 Q2678R probably benign Het
Cideb G A 14: 55,755,168 T97M probably damaging Het
Clca4b T C 3: 144,932,396 D35G probably benign Het
Clpx T C 9: 65,299,931 V37A probably benign Het
Cmya5 A C 13: 93,094,262 S1439R probably benign Het
Cndp2 T A 18: 84,670,820 H279L probably benign Het
Cngb1 A T 8: 95,298,804 probably null Het
Cpq T A 15: 33,497,297 N394K possibly damaging Het
Dedd T C 1: 171,338,494 L60P probably benign Het
Dennd3 C A 15: 73,570,775 L1216M possibly damaging Het
Dntt A T 19: 41,029,632 N65I probably benign Het
Fap T A 2: 62,503,414 E662V probably damaging Het
Fasn A T 11: 120,809,995 M2066K probably benign Het
Fggy G A 4: 95,600,966 G69E probably benign Het
Foxc1 G T 13: 31,808,756 G517C unknown Het
Gas2l3 A G 10: 89,413,370 Y629H probably benign Het
Gcnt2 A G 13: 40,918,241 N120S probably damaging Het
Gfpt2 A G 11: 49,823,315 T300A probably benign Het
Glud1 A G 14: 34,343,649 R535G probably damaging Het
Gm3248 T A 14: 5,943,883 I114L probably benign Het
Gm3278 G A 14: 4,895,172 probably null Het
Gm3402 A C 5: 146,514,280 K44Q probably damaging Het
Gm3696 C G 14: 7,087,893 R188S probably benign Het
Gm3696 C A 14: 7,087,894 R188M probably benign Het
Gmppa T C 1: 75,438,937 L113P probably damaging Het
Gmps A G 3: 63,982,670 probably null Het
Gnal T A 18: 67,213,074 M275K probably damaging Het
Gopc G C 10: 52,353,429 N231K probably damaging Het
Gpr152 T C 19: 4,143,488 S343P probably benign Het
Gpr17 T C 18: 31,947,540 I157V probably benign Het
Grm7 T A 6: 111,246,353 Y451* probably null Het
Ikbke T C 1: 131,271,898 E286G probably damaging Het
Inpp5b A T 4: 124,785,088 probably null Het
Iqgap2 G A 13: 95,682,257 L664F probably benign Het
Kif17 A G 4: 138,288,196 E552G possibly damaging Het
Lamtor1 T A 7: 101,906,013 Y5* probably null Het
Lpin2 A G 17: 71,245,171 I829V probably damaging Het
Lrg1 T G 17: 56,119,967 D335A probably benign Het
Lrriq3 T C 3: 155,098,807 Y35H probably damaging Het
Mkx T A 18: 7,000,607 M112L probably benign Het
Mlxipl A C 5: 135,134,543 D760A possibly damaging Het
Muc6 T C 7: 141,637,474 T2429A possibly damaging Het
N4bp2l2 A G 5: 150,643,250 C134R unknown Het
Nanos1 A G 19: 60,756,534 E90G probably benign Het
Nckap1 T C 2: 80,541,499 D329G probably damaging Het
Olfr112 A C 17: 37,564,221 L30R probably damaging Het
Olfr46 T C 7: 140,610,772 I194T probably benign Het
Olfr876 T C 9: 37,804,576 S222P probably damaging Het
Olfr919 G T 9: 38,698,271 L32I probably benign Het
Osbpl7 A G 11: 97,056,128 H419R probably benign Het
Otog C T 7: 46,285,776 T1395I probably benign Het
Pigq T A 17: 25,931,726 I451F probably benign Het
Ptgfrn A G 3: 101,077,132 V248A possibly damaging Het
Rdh19 G T 10: 127,856,871 V136L probably damaging Het
Rfesd T C 13: 76,008,189 T33A possibly damaging Het
Rnf213 G A 11: 119,411,545 V432M Het
Rpl22l1 T A 3: 28,806,813 L60Q probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,920 probably benign Het
Samd3 A G 10: 26,244,527 T140A probably benign Het
Sbf1 A G 15: 89,305,420 V419A possibly damaging Het
Serpinb6a T C 13: 33,935,565 probably null Het
Slc22a4 A G 11: 53,990,650 L414P probably damaging Het
Smarcd3 A T 5: 24,593,262 V420D probably benign Het
Tcaim A G 9: 122,834,930 D495G probably damaging Het
Tcrg-C2 A T 13: 19,307,220 probably benign Het
Tep1 A G 14: 50,836,809 V1873A possibly damaging Het
Tmcc2 T C 1: 132,360,789 N387D probably damaging Het
Tmed8 A T 12: 87,172,430 I322N probably damaging Het
Tmod4 A C 3: 95,127,604 D168A probably benign Het
Trp53bp1 C T 2: 121,205,061 E1520K probably damaging Het
Trpv5 T A 6: 41,674,933 I183F probably damaging Het
Vmn2r70 A T 7: 85,559,193 I692K probably benign Het
Vmn2r87 T A 10: 130,479,810 Y129F probably benign Het
Vps8 A G 16: 21,459,751 D253G probably damaging Het
Ythdc2 T C 18: 44,844,286 I383T possibly damaging Het
Ythdc2 T C 18: 44,850,424 S553P probably benign Het
Zfyve26 A G 12: 79,280,355 probably null Het
Zic1 G A 9: 91,364,971 T16I probably damaging Het
Other mutations in Ccdc180
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01369:Ccdc180 APN 4 45900256 missense probably benign
IGL01713:Ccdc180 APN 4 45921025 critical splice donor site probably null
IGL01915:Ccdc180 APN 4 45904544 missense probably damaging 0.98
IGL01935:Ccdc180 APN 4 45906889 missense possibly damaging 0.71
IGL02539:Ccdc180 APN 4 45921005 missense probably damaging 1.00
IGL02982:Ccdc180 APN 4 45903840 splice site probably benign
IGL03071:Ccdc180 APN 4 45903840 splice site probably benign
IGL03146:Ccdc180 APN 4 45903840 splice site probably benign
PIT4687001:Ccdc180 UTSW 4 45949526 missense probably damaging 1.00
R0049:Ccdc180 UTSW 4 45930119 critical splice acceptor site probably null
R0049:Ccdc180 UTSW 4 45930119 critical splice acceptor site probably null
R0054:Ccdc180 UTSW 4 45890900 missense probably benign 0.01
R0054:Ccdc180 UTSW 4 45890900 missense probably benign 0.01
R0080:Ccdc180 UTSW 4 45896205 missense probably null 0.00
R0082:Ccdc180 UTSW 4 45896205 missense probably null 0.00
R0126:Ccdc180 UTSW 4 45912866 critical splice donor site probably null
R0193:Ccdc180 UTSW 4 45914803 missense probably benign 0.01
R0276:Ccdc180 UTSW 4 45923534 missense probably damaging 1.00
R0362:Ccdc180 UTSW 4 45923551 missense probably damaging 1.00
R0380:Ccdc180 UTSW 4 45930197 critical splice donor site probably null
R0468:Ccdc180 UTSW 4 45923271 missense possibly damaging 0.87
R0539:Ccdc180 UTSW 4 45922010 missense probably damaging 0.97
R0543:Ccdc180 UTSW 4 45900041 nonsense probably null
R0546:Ccdc180 UTSW 4 45904597 missense possibly damaging 0.71
R0612:Ccdc180 UTSW 4 45927969 missense probably damaging 0.98
R0792:Ccdc180 UTSW 4 45927975 missense possibly damaging 0.92
R1056:Ccdc180 UTSW 4 45916375 missense probably benign 0.01
R1099:Ccdc180 UTSW 4 45914225 missense probably benign 0.03
R1136:Ccdc180 UTSW 4 45914589 missense probably benign 0.00
R1263:Ccdc180 UTSW 4 45903887 missense possibly damaging 0.85
R1331:Ccdc180 UTSW 4 45909359 missense possibly damaging 0.51
R1522:Ccdc180 UTSW 4 45927975 missense possibly damaging 0.92
R1819:Ccdc180 UTSW 4 45926195 missense possibly damaging 0.84
R2022:Ccdc180 UTSW 4 45944418 missense probably benign 0.18
R2056:Ccdc180 UTSW 4 45932477 missense probably benign 0.03
R2219:Ccdc180 UTSW 4 45944949 missense probably damaging 1.00
R2228:Ccdc180 UTSW 4 45948856 critical splice donor site probably null
R2229:Ccdc180 UTSW 4 45948856 critical splice donor site probably null
R2255:Ccdc180 UTSW 4 45921996 missense probably damaging 1.00
R2427:Ccdc180 UTSW 4 45929545 missense probably benign 0.03
R3001:Ccdc180 UTSW 4 45899988 missense probably benign
R3002:Ccdc180 UTSW 4 45899988 missense probably benign
R3003:Ccdc180 UTSW 4 45899988 missense probably benign
R3110:Ccdc180 UTSW 4 45900470 missense possibly damaging 0.86
R3111:Ccdc180 UTSW 4 45900470 missense possibly damaging 0.86
R3112:Ccdc180 UTSW 4 45900470 missense possibly damaging 0.86
R3898:Ccdc180 UTSW 4 45912799 missense possibly damaging 0.71
R4022:Ccdc180 UTSW 4 45904560 nonsense probably null
R4084:Ccdc180 UTSW 4 45950632 missense probably benign 0.19
R4377:Ccdc180 UTSW 4 45941877 missense probably damaging 1.00
R4595:Ccdc180 UTSW 4 45945023 missense probably damaging 0.98
R4637:Ccdc180 UTSW 4 45914443 missense probably benign
R4811:Ccdc180 UTSW 4 45928020 missense probably damaging 1.00
R4825:Ccdc180 UTSW 4 45912794 missense possibly damaging 0.93
R4858:Ccdc180 UTSW 4 45923244 missense probably damaging 1.00
R4888:Ccdc180 UTSW 4 45909308 missense probably damaging 0.98
R4940:Ccdc180 UTSW 4 45917453 missense probably damaging 0.96
R4940:Ccdc180 UTSW 4 45917508 missense probably damaging 1.00
R5042:Ccdc180 UTSW 4 45916255 missense probably damaging 0.98
R5119:Ccdc180 UTSW 4 45914603 missense possibly damaging 0.72
R5177:Ccdc180 UTSW 4 45917508 missense probably damaging 1.00
R5311:Ccdc180 UTSW 4 45917556 missense probably damaging 1.00
R5333:Ccdc180 UTSW 4 45890935 missense possibly damaging 0.53
R5448:Ccdc180 UTSW 4 45920913 missense probably damaging 1.00
R5510:Ccdc180 UTSW 4 45928046 missense probably damaging 0.96
R6018:Ccdc180 UTSW 4 45926235 missense probably damaging 1.00
R6108:Ccdc180 UTSW 4 45911389 missense possibly damaging 0.71
R6283:Ccdc180 UTSW 4 45902486 missense possibly damaging 0.85
R6483:Ccdc180 UTSW 4 45921950 missense probably benign 0.32
R6618:Ccdc180 UTSW 4 45950708 missense probably damaging 1.00
R7017:Ccdc180 UTSW 4 45940934 missense possibly damaging 0.84
R7205:Ccdc180 UTSW 4 45914588 missense probably benign
R7341:Ccdc180 UTSW 4 45898644 missense possibly damaging 0.85
R7351:Ccdc180 UTSW 4 45903887 missense possibly damaging 0.85
R7418:Ccdc180 UTSW 4 45904616 missense probably damaging 0.98
R7492:Ccdc180 UTSW 4 45930009 splice site probably null
R7573:Ccdc180 UTSW 4 45922015 missense probably benign 0.33
R7639:Ccdc180 UTSW 4 45928043 missense possibly damaging 0.93
R7792:Ccdc180 UTSW 4 45890389 critical splice donor site probably null
R7812:Ccdc180 UTSW 4 45906952 critical splice donor site probably null
R7840:Ccdc180 UTSW 4 45900461 missense possibly damaging 0.71
R7842:Ccdc180 UTSW 4 45909428 missense probably benign 0.00
X0017:Ccdc180 UTSW 4 45909350 missense possibly damaging 0.86
Z1176:Ccdc180 UTSW 4 45916406 missense probably damaging 1.00
Z1176:Ccdc180 UTSW 4 45920910 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGTTCCCTTCACACAGTGG -3'
(R):5'- CCTTGACATCCTGACATGGAATTC -3'

Sequencing Primer
(F):5'- ACACAGTGGTCTCATCTCCC -3'
(R):5'- GCAGACTTAAGGATGGCTTCC -3'
Posted On2019-11-26