Incidental Mutation 'R7806:Olfr876'
ID600782
Institutional Source Beutler Lab
Gene Symbol Olfr876
Ensembl Gene ENSMUSG00000066750
Gene Nameolfactory receptor 876
SynonymsGA_x6K02T2PVTD-31489645-31490577, MOR161-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R7806 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location37803031-37808144 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37804576 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 222 (S222P)
Ref Sequence ENSEMBL: ENSMUSP00000149930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086064] [ENSMUST00000213368] [ENSMUST00000215287]
Predicted Effect probably damaging
Transcript: ENSMUST00000086064
AA Change: S222P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000083231
Gene: ENSMUSG00000066750
AA Change: S222P

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 1.6e-47 PFAM
Pfam:7tm_1 40 289 3.2e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213368
AA Change: S222P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000215287
AA Change: S222P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik C A 8: 124,842,404 V144F probably benign Het
Aar2 T A 2: 156,551,111 I140N possibly damaging Het
Abca15 A G 7: 120,332,836 N104S probably damaging Het
Adam22 A T 5: 8,092,825 N803K probably damaging Het
Adk A G 14: 21,326,611 N26S Het
Ak9 A C 10: 41,433,084 probably null Het
Alpk2 T C 18: 65,349,416 D40G probably benign Het
Ankrd65 A T 4: 155,792,980 H316L probably benign Het
Cabp7 C T 11: 4,738,889 A194T probably damaging Het
Ccdc180 A C 4: 45,912,801 K593N possibly damaging Het
Cd80 A G 16: 38,473,953 D66G probably benign Het
Cdh5 T C 8: 104,140,816 V575A probably damaging Het
Cep350 T C 1: 155,862,063 Q2678R probably benign Het
Cideb G A 14: 55,755,168 T97M probably damaging Het
Clca4b T C 3: 144,932,396 D35G probably benign Het
Clpx T C 9: 65,299,931 V37A probably benign Het
Cmya5 A C 13: 93,094,262 S1439R probably benign Het
Cndp2 T A 18: 84,670,820 H279L probably benign Het
Cngb1 A T 8: 95,298,804 probably null Het
Cpq T A 15: 33,497,297 N394K possibly damaging Het
Dedd T C 1: 171,338,494 L60P probably benign Het
Dennd3 C A 15: 73,570,775 L1216M possibly damaging Het
Dntt A T 19: 41,029,632 N65I probably benign Het
Fap T A 2: 62,503,414 E662V probably damaging Het
Fasn A T 11: 120,809,995 M2066K probably benign Het
Foxc1 G T 13: 31,808,756 G517C unknown Het
Gas2l3 A G 10: 89,413,370 Y629H probably benign Het
Gcnt2 A G 13: 40,918,241 N120S probably damaging Het
Gfpt2 A G 11: 49,823,315 T300A probably benign Het
Glud1 A G 14: 34,343,649 R535G probably damaging Het
Gm3248 T A 14: 5,943,883 I114L probably benign Het
Gm3278 G A 14: 4,895,172 probably null Het
Gm3402 A C 5: 146,514,280 K44Q probably damaging Het
Gm3696 C G 14: 7,087,893 R188S probably benign Het
Gm3696 C A 14: 7,087,894 R188M probably benign Het
Gmppa T C 1: 75,438,937 L113P probably damaging Het
Gnal T A 18: 67,213,074 M275K probably damaging Het
Gopc G C 10: 52,353,429 N231K probably damaging Het
Gpr152 T C 19: 4,143,488 S343P probably benign Het
Gpr17 T C 18: 31,947,540 I157V probably benign Het
Grm7 T A 6: 111,246,353 Y451* probably null Het
Ikbke T C 1: 131,271,898 E286G probably damaging Het
Iqgap2 G A 13: 95,682,257 L664F probably benign Het
Kif17 A G 4: 138,288,196 E552G possibly damaging Het
Lamtor1 T A 7: 101,906,013 Y5* probably null Het
Lpin2 A G 17: 71,245,171 I829V probably damaging Het
Lrg1 T G 17: 56,119,967 D335A probably benign Het
Lrriq3 T C 3: 155,098,807 Y35H probably damaging Het
Mkx T A 18: 7,000,607 M112L probably benign Het
Mlxipl A C 5: 135,134,543 D760A possibly damaging Het
Muc6 T C 7: 141,637,474 T2429A possibly damaging Het
N4bp2l2 A G 5: 150,643,250 C134R unknown Het
Nanos1 A G 19: 60,756,534 E90G probably benign Het
Nckap1 T C 2: 80,541,499 D329G probably damaging Het
Olfr112 A C 17: 37,564,221 L30R probably damaging Het
Olfr46 T C 7: 140,610,772 I194T probably benign Het
Olfr919 G T 9: 38,698,271 L32I probably benign Het
Osbpl7 A G 11: 97,056,128 H419R probably benign Het
Otog C T 7: 46,285,776 T1395I probably benign Het
Pigq T A 17: 25,931,726 I451F probably benign Het
Ptgfrn A G 3: 101,077,132 V248A possibly damaging Het
Rdh19 G T 10: 127,856,871 V136L probably damaging Het
Rfesd T C 13: 76,008,189 T33A possibly damaging Het
Rnf213 G A 11: 119,411,545 V432M Het
Rpl22l1 T A 3: 28,806,813 L60Q probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,920 probably benign Het
Samd3 A G 10: 26,244,527 T140A probably benign Het
Sbf1 A G 15: 89,305,420 V419A possibly damaging Het
Slc22a4 A G 11: 53,990,650 L414P probably damaging Het
Smarcd3 A T 5: 24,593,262 V420D probably benign Het
Tcaim A G 9: 122,834,930 D495G probably damaging Het
Tcrg-C2 A T 13: 19,307,220 probably benign Het
Tep1 A G 14: 50,836,809 V1873A possibly damaging Het
Tmcc2 T C 1: 132,360,789 N387D probably damaging Het
Tmed8 A T 12: 87,172,430 I322N probably damaging Het
Tmod4 A C 3: 95,127,604 D168A probably benign Het
Trp53bp1 C T 2: 121,205,061 E1520K probably damaging Het
Trpv5 T A 6: 41,674,933 I183F probably damaging Het
Vmn2r70 A T 7: 85,559,193 I692K probably benign Het
Vmn2r87 T A 10: 130,479,810 Y129F probably benign Het
Vps8 A G 16: 21,459,751 D253G probably damaging Het
Ythdc2 T C 18: 44,844,286 I383T possibly damaging Het
Ythdc2 T C 18: 44,850,424 S553P probably benign Het
Zfyve26 A G 12: 79,280,355 probably null Het
Zic1 G A 9: 91,364,971 T16I probably damaging Het
Other mutations in Olfr876
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Olfr876 APN 9 37804782 missense probably damaging 1.00
IGL01330:Olfr876 APN 9 37804220 missense probably damaging 1.00
IGL02105:Olfr876 APN 9 37804595 missense possibly damaging 0.53
IGL02505:Olfr876 APN 9 37804331 missense probably benign 0.08
R1543:Olfr876 UTSW 9 37803947 missense possibly damaging 0.94
R1768:Olfr876 UTSW 9 37804303 missense probably damaging 1.00
R1960:Olfr876 UTSW 9 37803946 missense probably benign 0.01
R2567:Olfr876 UTSW 9 37804213 missense probably damaging 1.00
R3815:Olfr876 UTSW 9 37804169 missense probably benign 0.05
R3816:Olfr876 UTSW 9 37804169 missense probably benign 0.05
R3817:Olfr876 UTSW 9 37804169 missense probably benign 0.05
R3819:Olfr876 UTSW 9 37804169 missense probably benign 0.05
R4364:Olfr876 UTSW 9 37804190 missense probably benign 0.19
R4366:Olfr876 UTSW 9 37804190 missense probably benign 0.19
R4620:Olfr876 UTSW 9 37804819 missense probably benign 0.02
R5530:Olfr876 UTSW 9 37804807 missense probably benign 0.00
R6199:Olfr876 UTSW 9 37804881 utr 3 prime probably null
R6238:Olfr876 UTSW 9 37804021 missense probably benign 0.26
R6893:Olfr876 UTSW 9 37804845 makesense probably null
R7404:Olfr876 UTSW 9 37803961 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TGGCCCACACCATATCCATG -3'
(R):5'- TCTCAAGCTATAGATCAGAGGATTC -3'

Sequencing Primer
(F):5'- TATCCATGGCAAGGCTGAC -3'
(R):5'- TAGATCAGAGGATTCAACATAGGTAC -3'
Posted On2019-11-26