Incidental Mutation 'R7806:Cmya5'
ID600805
Institutional Source Beutler Lab
Gene Symbol Cmya5
Ensembl Gene ENSMUSG00000047419
Gene Namecardiomyopathy associated 5
SynonymsMyospryn, 2310076E21Rik, 2310076E16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.406) question?
Stock #R7806 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location93040713-93144724 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 93094262 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 1439 (S1439R)
Ref Sequence ENSEMBL: ENSMUSP00000050408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062122]
Predicted Effect probably benign
Transcript: ENSMUST00000062122
AA Change: S1439R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000050408
Gene: ENSMUSG00000047419
AA Change: S1439R

DomainStartEndE-ValueType
low complexity region 20 46 N/A INTRINSIC
low complexity region 129 140 N/A INTRINSIC
internal_repeat_1 448 535 5.09e-18 PROSPERO
internal_repeat_1 543 625 5.09e-18 PROSPERO
low complexity region 626 645 N/A INTRINSIC
low complexity region 679 691 N/A INTRINSIC
low complexity region 734 741 N/A INTRINSIC
low complexity region 1001 1010 N/A INTRINSIC
low complexity region 1166 1183 N/A INTRINSIC
low complexity region 1259 1267 N/A INTRINSIC
low complexity region 1440 1449 N/A INTRINSIC
low complexity region 1876 1889 N/A INTRINSIC
low complexity region 2632 2645 N/A INTRINSIC
low complexity region 3048 3057 N/A INTRINSIC
FN3 3312 3399 7.29e-4 SMART
FN3 3411 3492 1.3e0 SMART
Pfam:SPRY 3551 3668 6.7e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (83/85)
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik C A 8: 124,842,404 V144F probably benign Het
Aar2 T A 2: 156,551,111 I140N possibly damaging Het
Abca15 A G 7: 120,332,836 N104S probably damaging Het
Adam22 A T 5: 8,092,825 N803K probably damaging Het
Adk A G 14: 21,326,611 N26S Het
Ak9 A C 10: 41,433,084 probably null Het
Alpk2 T C 18: 65,349,416 D40G probably benign Het
Ankrd65 A T 4: 155,792,980 H316L probably benign Het
Cabp7 C T 11: 4,738,889 A194T probably damaging Het
Ccdc180 A C 4: 45,912,801 K593N possibly damaging Het
Cd80 A G 16: 38,473,953 D66G probably benign Het
Cdh5 T C 8: 104,140,816 V575A probably damaging Het
Cep350 T C 1: 155,862,063 Q2678R probably benign Het
Cideb G A 14: 55,755,168 T97M probably damaging Het
Clca4b T C 3: 144,932,396 D35G probably benign Het
Clpx T C 9: 65,299,931 V37A probably benign Het
Cndp2 T A 18: 84,670,820 H279L probably benign Het
Cngb1 A T 8: 95,298,804 probably null Het
Cpq T A 15: 33,497,297 N394K possibly damaging Het
Dedd T C 1: 171,338,494 L60P probably benign Het
Dennd3 C A 15: 73,570,775 L1216M possibly damaging Het
Dntt A T 19: 41,029,632 N65I probably benign Het
Fap T A 2: 62,503,414 E662V probably damaging Het
Fasn A T 11: 120,809,995 M2066K probably benign Het
Fggy G A 4: 95,600,966 G69E probably benign Het
Foxc1 G T 13: 31,808,756 G517C unknown Het
Gas2l3 A G 10: 89,413,370 Y629H probably benign Het
Gcnt2 A G 13: 40,918,241 N120S probably damaging Het
Gfpt2 A G 11: 49,823,315 T300A probably benign Het
Glud1 A G 14: 34,343,649 R535G probably damaging Het
Gm3248 T A 14: 5,943,883 I114L probably benign Het
Gm3278 G A 14: 4,895,172 probably null Het
Gm3402 A C 5: 146,514,280 K44Q probably damaging Het
Gm3696 C G 14: 7,087,893 R188S probably benign Het
Gm3696 C A 14: 7,087,894 R188M probably benign Het
Gmppa T C 1: 75,438,937 L113P probably damaging Het
Gmps A G 3: 63,982,670 probably null Het
Gnal T A 18: 67,213,074 M275K probably damaging Het
Gopc G C 10: 52,353,429 N231K probably damaging Het
Gpr152 T C 19: 4,143,488 S343P probably benign Het
Gpr17 T C 18: 31,947,540 I157V probably benign Het
Grm7 T A 6: 111,246,353 Y451* probably null Het
Ikbke T C 1: 131,271,898 E286G probably damaging Het
Inpp5b A T 4: 124,785,088 probably null Het
Iqgap2 G A 13: 95,682,257 L664F probably benign Het
Kif17 A G 4: 138,288,196 E552G possibly damaging Het
Lamtor1 T A 7: 101,906,013 Y5* probably null Het
Lpin2 A G 17: 71,245,171 I829V probably damaging Het
Lrg1 T G 17: 56,119,967 D335A probably benign Het
Lrriq3 T C 3: 155,098,807 Y35H probably damaging Het
Mkx T A 18: 7,000,607 M112L probably benign Het
Mlxipl A C 5: 135,134,543 D760A possibly damaging Het
Muc6 T C 7: 141,637,474 T2429A possibly damaging Het
N4bp2l2 A G 5: 150,643,250 C134R unknown Het
Nanos1 A G 19: 60,756,534 E90G probably benign Het
Nckap1 T C 2: 80,541,499 D329G probably damaging Het
Olfr112 A C 17: 37,564,221 L30R probably damaging Het
Olfr46 T C 7: 140,610,772 I194T probably benign Het
Olfr876 T C 9: 37,804,576 S222P probably damaging Het
Olfr919 G T 9: 38,698,271 L32I probably benign Het
Osbpl7 A G 11: 97,056,128 H419R probably benign Het
Otog C T 7: 46,285,776 T1395I probably benign Het
Pigq T A 17: 25,931,726 I451F probably benign Het
Ptgfrn A G 3: 101,077,132 V248A possibly damaging Het
Rdh19 G T 10: 127,856,871 V136L probably damaging Het
Rfesd T C 13: 76,008,189 T33A possibly damaging Het
Rnf213 G A 11: 119,411,545 V432M Het
Rpl22l1 T A 3: 28,806,813 L60Q probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,920 probably benign Het
Samd3 A G 10: 26,244,527 T140A probably benign Het
Sbf1 A G 15: 89,305,420 V419A possibly damaging Het
Serpinb6a T C 13: 33,935,565 probably null Het
Slc22a4 A G 11: 53,990,650 L414P probably damaging Het
Smarcd3 A T 5: 24,593,262 V420D probably benign Het
Tcaim A G 9: 122,834,930 D495G probably damaging Het
Tcrg-C2 A T 13: 19,307,220 probably benign Het
Tep1 A G 14: 50,836,809 V1873A possibly damaging Het
Tmcc2 T C 1: 132,360,789 N387D probably damaging Het
Tmed8 A T 12: 87,172,430 I322N probably damaging Het
Tmod4 A C 3: 95,127,604 D168A probably benign Het
Trp53bp1 C T 2: 121,205,061 E1520K probably damaging Het
Trpv5 T A 6: 41,674,933 I183F probably damaging Het
Vmn2r70 A T 7: 85,559,193 I692K probably benign Het
Vmn2r87 T A 10: 130,479,810 Y129F probably benign Het
Vps8 A G 16: 21,459,751 D253G probably damaging Het
Ythdc2 T C 18: 44,844,286 I383T possibly damaging Het
Ythdc2 T C 18: 44,850,424 S553P probably benign Het
Zfyve26 A G 12: 79,280,355 probably null Het
Zic1 G A 9: 91,364,971 T16I probably damaging Het
Other mutations in Cmya5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Cmya5 APN 13 93093120 missense probably benign 0.13
IGL00516:Cmya5 APN 13 93098167 missense possibly damaging 0.73
IGL00654:Cmya5 APN 13 93094161 missense probably benign 0.00
IGL00948:Cmya5 APN 13 93091036 missense probably benign
IGL00966:Cmya5 APN 13 93097906 missense probably benign 0.33
IGL00988:Cmya5 APN 13 93097933 missense possibly damaging 0.96
IGL01106:Cmya5 APN 13 93084612 missense probably damaging 1.00
IGL01331:Cmya5 APN 13 93096946 missense possibly damaging 0.53
IGL01392:Cmya5 APN 13 93089206 missense probably damaging 0.99
IGL01508:Cmya5 APN 13 93094027 missense probably benign
IGL01679:Cmya5 APN 13 93065320 missense probably damaging 1.00
IGL01749:Cmya5 APN 13 93089299 missense probably benign 0.00
IGL01861:Cmya5 APN 13 93089748 missense probably damaging 1.00
IGL02021:Cmya5 APN 13 93094549 missense probably benign 0.00
IGL02034:Cmya5 APN 13 93084535 splice site probably benign
IGL02103:Cmya5 APN 13 93092127 missense probably benign 0.05
IGL02174:Cmya5 APN 13 93048907 missense possibly damaging 0.76
IGL02176:Cmya5 APN 13 93090150 missense probably damaging 1.00
IGL02210:Cmya5 APN 13 93092734 missense probably benign 0.14
IGL02229:Cmya5 APN 13 93092686 missense possibly damaging 0.54
IGL02306:Cmya5 APN 13 93098019 missense probably damaging 1.00
IGL02311:Cmya5 APN 13 93090655 missense probably benign 0.40
IGL02409:Cmya5 APN 13 93090198 missense probably damaging 0.96
IGL02561:Cmya5 APN 13 93091858 missense probably benign 0.00
IGL02676:Cmya5 APN 13 93092853 missense probably damaging 1.00
IGL02683:Cmya5 APN 13 93090997 nonsense probably null
IGL02685:Cmya5 APN 13 93090997 nonsense probably null
IGL02686:Cmya5 APN 13 93090997 nonsense probably null
IGL02724:Cmya5 APN 13 93096655 missense probably benign
IGL02727:Cmya5 APN 13 93098245 missense possibly damaging 0.73
IGL02965:Cmya5 APN 13 93092557 missense probably benign 0.41
IGL03079:Cmya5 APN 13 93097701 missense possibly damaging 0.85
IGL03144:Cmya5 APN 13 93090868 missense probably damaging 1.00
IGL03253:Cmya5 APN 13 93091270 nonsense probably null
IGL03336:Cmya5 APN 13 93093505 missense possibly damaging 0.84
IGL03138:Cmya5 UTSW 13 93065342 missense probably damaging 1.00
P0023:Cmya5 UTSW 13 93089346 missense probably benign 0.22
P4748:Cmya5 UTSW 13 93074475 splice site probably benign
R0123:Cmya5 UTSW 13 93095904 missense possibly damaging 0.84
R0206:Cmya5 UTSW 13 93095557 missense probably damaging 0.98
R0206:Cmya5 UTSW 13 93095557 missense probably damaging 0.98
R0242:Cmya5 UTSW 13 93095600 missense probably benign
R0242:Cmya5 UTSW 13 93095600 missense probably benign
R0331:Cmya5 UTSW 13 93144403 missense possibly damaging 0.53
R0363:Cmya5 UTSW 13 93094869 missense possibly damaging 0.77
R0382:Cmya5 UTSW 13 93092748 missense probably benign 0.06
R0416:Cmya5 UTSW 13 93089856 missense probably benign 0.05
R0446:Cmya5 UTSW 13 93093656 missense probably benign
R0457:Cmya5 UTSW 13 93095587 missense possibly damaging 0.84
R0673:Cmya5 UTSW 13 93089997 missense probably damaging 1.00
R0674:Cmya5 UTSW 13 93092791 missense probably damaging 1.00
R0692:Cmya5 UTSW 13 93093849 nonsense probably null
R0698:Cmya5 UTSW 13 93095557 missense probably damaging 0.98
R1227:Cmya5 UTSW 13 93094446 missense probably damaging 0.99
R1272:Cmya5 UTSW 13 93095112 missense possibly damaging 0.79
R1335:Cmya5 UTSW 13 93041535 missense possibly damaging 0.65
R1353:Cmya5 UTSW 13 93041525 missense probably damaging 1.00
R1354:Cmya5 UTSW 13 93092058 missense possibly damaging 0.46
R1458:Cmya5 UTSW 13 93065327 missense probably benign 0.44
R1572:Cmya5 UTSW 13 93094269 missense possibly damaging 0.61
R1698:Cmya5 UTSW 13 93063519 missense probably benign 0.27
R1735:Cmya5 UTSW 13 93089789 missense probably benign 0.11
R1743:Cmya5 UTSW 13 93097317 missense probably benign 0.33
R1750:Cmya5 UTSW 13 93095663 missense probably benign
R1827:Cmya5 UTSW 13 93074448 missense possibly damaging 0.80
R2068:Cmya5 UTSW 13 93090524 missense possibly damaging 0.93
R2088:Cmya5 UTSW 13 93092812 missense probably damaging 1.00
R2132:Cmya5 UTSW 13 93069383 missense probably damaging 1.00
R2216:Cmya5 UTSW 13 93093495 missense probably damaging 1.00
R2363:Cmya5 UTSW 13 93093702 missense probably benign 0.15
R2497:Cmya5 UTSW 13 93098005 missense possibly damaging 0.53
R2509:Cmya5 UTSW 13 93093558 missense probably benign 0.41
R2917:Cmya5 UTSW 13 93091064 nonsense probably null
R2944:Cmya5 UTSW 13 93092842 nonsense probably null
R3039:Cmya5 UTSW 13 93092250 missense probably benign 0.12
R3078:Cmya5 UTSW 13 93048927 missense probably damaging 0.99
R3708:Cmya5 UTSW 13 93095366 nonsense probably null
R3717:Cmya5 UTSW 13 93092487 missense probably benign 0.12
R3768:Cmya5 UTSW 13 93096693 missense possibly damaging 0.73
R3769:Cmya5 UTSW 13 93096693 missense possibly damaging 0.73
R3840:Cmya5 UTSW 13 93094632 missense probably damaging 0.96
R3841:Cmya5 UTSW 13 93094632 missense probably damaging 0.96
R3882:Cmya5 UTSW 13 93091219 missense probably benign 0.07
R3888:Cmya5 UTSW 13 93093656 missense probably benign
R3897:Cmya5 UTSW 13 93096681 missense possibly damaging 0.72
R3952:Cmya5 UTSW 13 93089199 missense possibly damaging 0.89
R4366:Cmya5 UTSW 13 93091956 missense probably benign 0.36
R4471:Cmya5 UTSW 13 93092325 missense probably benign 0.01
R4493:Cmya5 UTSW 13 93094065 missense probably benign
R4495:Cmya5 UTSW 13 93094065 missense probably benign
R4544:Cmya5 UTSW 13 93091918 nonsense probably null
R4545:Cmya5 UTSW 13 93091918 nonsense probably null
R4624:Cmya5 UTSW 13 93063551 missense probably damaging 1.00
R4648:Cmya5 UTSW 13 93093828 missense possibly damaging 0.84
R4824:Cmya5 UTSW 13 93093574 missense probably benign 0.04
R4965:Cmya5 UTSW 13 93095787 missense possibly damaging 0.84
R4967:Cmya5 UTSW 13 93090585 missense probably damaging 1.00
R5101:Cmya5 UTSW 13 93091603 missense possibly damaging 0.61
R5133:Cmya5 UTSW 13 93093372 missense possibly damaging 0.79
R5139:Cmya5 UTSW 13 93096061 missense probably benign 0.00
R5220:Cmya5 UTSW 13 93092296 missense probably damaging 0.99
R5332:Cmya5 UTSW 13 93096195 missense probably damaging 0.96
R5337:Cmya5 UTSW 13 93083273 missense probably benign 0.28
R5356:Cmya5 UTSW 13 93063485 missense probably damaging 1.00
R5401:Cmya5 UTSW 13 93091968 missense probably damaging 1.00
R5438:Cmya5 UTSW 13 93095199 missense possibly damaging 0.89
R5604:Cmya5 UTSW 13 93092763 missense probably benign 0.15
R5628:Cmya5 UTSW 13 93089710 missense probably damaging 1.00
R5666:Cmya5 UTSW 13 93045949 missense possibly damaging 0.75
R5687:Cmya5 UTSW 13 93098176 missense possibly damaging 0.53
R5695:Cmya5 UTSW 13 93045866 critical splice donor site probably null
R5806:Cmya5 UTSW 13 93093937 missense possibly damaging 0.84
R5820:Cmya5 UTSW 13 93092780 missense probably benign 0.04
R5872:Cmya5 UTSW 13 93097435 missense probably benign 0.01
R5875:Cmya5 UTSW 13 93095184 missense probably benign 0.13
R5896:Cmya5 UTSW 13 93045865 critical splice donor site probably null
R5910:Cmya5 UTSW 13 93092643 missense probably damaging 0.98
R5969:Cmya5 UTSW 13 93089544 missense possibly damaging 0.78
R6064:Cmya5 UTSW 13 93089649 missense probably damaging 1.00
R6081:Cmya5 UTSW 13 93144513 unclassified probably benign
R6102:Cmya5 UTSW 13 93094231 missense probably benign
R6117:Cmya5 UTSW 13 93095166 missense probably damaging 0.98
R6188:Cmya5 UTSW 13 93093444 missense possibly damaging 0.61
R6188:Cmya5 UTSW 13 93097276 missense possibly damaging 0.73
R6219:Cmya5 UTSW 13 93094443 missense probably damaging 1.00
R6229:Cmya5 UTSW 13 93093306 missense probably benign 0.41
R6346:Cmya5 UTSW 13 93092190 missense probably damaging 1.00
R6431:Cmya5 UTSW 13 93074464 missense possibly damaging 0.60
R6436:Cmya5 UTSW 13 93089215 missense probably damaging 0.98
R6598:Cmya5 UTSW 13 93089808 missense probably benign 0.05
R6649:Cmya5 UTSW 13 93098025 missense possibly damaging 0.91
R6652:Cmya5 UTSW 13 93092895 missense probably benign 0.04
R6652:Cmya5 UTSW 13 93093039 missense probably damaging 0.99
R6669:Cmya5 UTSW 13 93093259 missense probably benign 0.03
R6881:Cmya5 UTSW 13 93090292 missense probably damaging 1.00
R6909:Cmya5 UTSW 13 93091252 missense probably benign 0.04
R6933:Cmya5 UTSW 13 93095136 missense probably benign 0.03
R7021:Cmya5 UTSW 13 93093555 missense possibly damaging 0.62
R7022:Cmya5 UTSW 13 93069278 critical splice donor site probably null
R7068:Cmya5 UTSW 13 93092697 missense possibly damaging 0.59
R7087:Cmya5 UTSW 13 93090975 missense probably benign 0.00
R7088:Cmya5 UTSW 13 93091864 missense possibly damaging 0.95
R7126:Cmya5 UTSW 13 93089940 missense probably benign 0.41
R7177:Cmya5 UTSW 13 93095328 missense probably benign 0.00
R7188:Cmya5 UTSW 13 93046038 missense probably damaging 1.00
R7217:Cmya5 UTSW 13 93090430 missense probably damaging 1.00
R7278:Cmya5 UTSW 13 93095700 missense probably damaging 0.96
R7293:Cmya5 UTSW 13 93092797 missense possibly damaging 0.90
R7332:Cmya5 UTSW 13 93092553 missense possibly damaging 0.60
R7375:Cmya5 UTSW 13 93091661 missense probably damaging 0.97
R7386:Cmya5 UTSW 13 93069323 missense probably damaging 1.00
R7489:Cmya5 UTSW 13 93091838 missense possibly damaging 0.87
R7529:Cmya5 UTSW 13 93097434 missense probably benign 0.02
R7552:Cmya5 UTSW 13 93069312 missense probably benign 0.41
R7624:Cmya5 UTSW 13 93090357 missense possibly damaging 0.79
R7637:Cmya5 UTSW 13 93083212 missense possibly damaging 0.87
R7673:Cmya5 UTSW 13 93094121 missense probably benign 0.13
R7753:Cmya5 UTSW 13 93098172 missense probably benign 0.18
R7757:Cmya5 UTSW 13 93098272 missense possibly damaging 0.53
R7825:Cmya5 UTSW 13 93097628 missense possibly damaging 0.53
R7878:Cmya5 UTSW 13 93089757 missense probably damaging 0.98
R7892:Cmya5 UTSW 13 93096357 missense probably damaging 0.96
R7952:Cmya5 UTSW 13 93097004 small deletion probably benign
R8127:Cmya5 UTSW 13 93094614 missense probably damaging 0.99
R8256:Cmya5 UTSW 13 93093478 missense possibly damaging 0.62
R8339:Cmya5 UTSW 13 93091634 nonsense probably null
R8446:Cmya5 UTSW 13 93093828 missense possibly damaging 0.84
R8553:Cmya5 UTSW 13 93093796 missense probably benign 0.00
R8686:Cmya5 UTSW 13 93095380 missense possibly damaging 0.91
R8748:Cmya5 UTSW 13 93089721 missense probably damaging 1.00
R8783:Cmya5 UTSW 13 93089380 missense possibly damaging 0.58
R8803:Cmya5 UTSW 13 93041483 missense probably damaging 1.00
R8810:Cmya5 UTSW 13 93063540 missense possibly damaging 0.47
RF020:Cmya5 UTSW 13 93069291 missense possibly damaging 0.56
X0028:Cmya5 UTSW 13 93096687 missense possibly damaging 0.53
Z1088:Cmya5 UTSW 13 93063579 missense probably benign
Z1176:Cmya5 UTSW 13 93063579 missense probably benign
Z1176:Cmya5 UTSW 13 93096790 missense unknown
Z1177:Cmya5 UTSW 13 93063579 missense probably benign
Predicted Primers PCR Primer
(F):5'- CATGCTGGGCAAAGGCAAAC -3'
(R):5'- AGAATGTTGTCAAAGAATGAGCCTG -3'

Sequencing Primer
(F):5'- ACTCCCTTTAAGCCTGGGTG -3'
(R):5'- TGTTGTCAAAGAATGAGCCTGAAGTG -3'
Posted On2019-11-26