Mutagenetix > Incidental Mutation

Incidental Mutation 'R7806:Cmya5'

600805

Institutional Source

Beutler Lab

Gene Symbol

Cmya5

Ensembl Gene

ENSMUSG00000047419

Gene Name

cardiomyopathy associated 5

Synonyms

Myospryn, 2310076E21Rik, 2310076E16Rik

MMRRC Submission

045861-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.326) question?

Stock #

R7806 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

93040713-93144724 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 93094262 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 1439 (S1439R)

Ref Sequence

ENSEMBL: ENSMUSP00000050408 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062122]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000062122
AA Change: S1439R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000050408
Gene: ENSMUSG00000047419
AA Change: S1439R

Domain	Start	End	E-Value	Type
low complexity region	20	46	N/A	INTRINSIC
low complexity region	129	140	N/A	INTRINSIC
internal_repeat_1	448	535	5.09e-18	PROSPERO
internal_repeat_1	543	625	5.09e-18	PROSPERO
low complexity region	626	645	N/A	INTRINSIC
low complexity region	679	691	N/A	INTRINSIC
low complexity region	734	741	N/A	INTRINSIC
low complexity region	1001	1010	N/A	INTRINSIC
low complexity region	1166	1183	N/A	INTRINSIC
low complexity region	1259	1267	N/A	INTRINSIC
low complexity region	1440	1449	N/A	INTRINSIC
low complexity region	1876	1889	N/A	INTRINSIC
low complexity region	2632	2645	N/A	INTRINSIC
low complexity region	3048	3057	N/A	INTRINSIC
FN3	3312	3399	7.29e-4	SMART
FN3	3411	3492	1.3e0	SMART
Pfam:SPRY	3551	3668	6.7e-8	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.8%
20x: 99.3%

Validation Efficiency

98% (83/85)

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810004N23Rik	C	A	8: 124,842,404	V144F	probably benign	Het
Aar2	T	A	2: 156,551,111	I140N	possibly damaging	Het
Abca15	A	G	7: 120,332,836	N104S	probably damaging	Het
Adam22	A	T	5: 8,092,825	N803K	probably damaging	Het
Adk	A	G	14: 21,326,611	N26S		Het
Ak9	A	C	10: 41,433,084		probably null	Het
Alpk2	T	C	18: 65,349,416	D40G	probably benign	Het
Ankrd65	A	T	4: 155,792,980	H316L	probably benign	Het
Cabp7	C	T	11: 4,738,889	A194T	probably damaging	Het
Ccdc180	A	C	4: 45,912,801	K593N	possibly damaging	Het
Cd80	A	G	16: 38,473,953	D66G	probably benign	Het
Cdh5	T	C	8: 104,140,816	V575A	probably damaging	Het
Cep350	T	C	1: 155,862,063	Q2678R	probably benign	Het
Cideb	G	A	14: 55,755,168	T97M	probably damaging	Het
Clca4b	T	C	3: 144,932,396	D35G	probably benign	Het
Clpx	T	C	9: 65,299,931	V37A	probably benign	Het
Cndp2	T	A	18: 84,670,820	H279L	probably benign	Het
Cngb1	A	T	8: 95,298,804		probably null	Het
Cpq	T	A	15: 33,497,297	N394K	possibly damaging	Het
Dedd	T	C	1: 171,338,494	L60P	probably benign	Het
Dennd3	C	A	15: 73,570,775	L1216M	possibly damaging	Het
Dntt	A	T	19: 41,029,632	N65I	probably benign	Het
Fap	T	A	2: 62,503,414	E662V	probably damaging	Het
Fasn	A	T	11: 120,809,995	M2066K	probably benign	Het
Fggy	G	A	4: 95,600,966	G69E	probably benign	Het
Foxc1	G	T	13: 31,808,756	G517C	unknown	Het
Gas2l3	A	G	10: 89,413,370	Y629H	probably benign	Het
Gcnt2	A	G	13: 40,918,241	N120S	probably damaging	Het
Gfpt2	A	G	11: 49,823,315	T300A	probably benign	Het
Glud1	A	G	14: 34,343,649	R535G	probably damaging	Het
Gm3248	T	A	14: 5,943,883	I114L	probably benign	Het
Gm3278	G	A	14: 4,895,172		probably null	Het
Gm3402	A	C	5: 146,514,280	K44Q	probably damaging	Het
Gm3696	C	G	14: 7,087,893	R188S	probably benign	Het
Gm3696	C	A	14: 7,087,894	R188M	probably benign	Het
Gmppa	T	C	1: 75,438,937	L113P	probably damaging	Het
Gmps	A	G	3: 63,982,670		probably null	Het
Gnal	T	A	18: 67,213,074	M275K	probably damaging	Het
Gopc	G	C	10: 52,353,429	N231K	probably damaging	Het
Gpr152	T	C	19: 4,143,488	S343P	probably benign	Het
Gpr17	T	C	18: 31,947,540	I157V	probably benign	Het
Grm7	T	A	6: 111,246,353	Y451*	probably null	Het
Ikbke	T	C	1: 131,271,898	E286G	probably damaging	Het
Inpp5b	A	T	4: 124,785,088		probably null	Het
Iqgap2	G	A	13: 95,682,257	L664F	probably benign	Het
Kif17	A	G	4: 138,288,196	E552G	possibly damaging	Het
Lamtor1	T	A	7: 101,906,013	Y5*	probably null	Het
Lpin2	A	G	17: 71,245,171	I829V	probably damaging	Het
Lrg1	T	G	17: 56,119,967	D335A	probably benign	Het
Lrriq3	T	C	3: 155,098,807	Y35H	probably damaging	Het
Mkx	T	A	18: 7,000,607	M112L	probably benign	Het
Mlxipl	A	C	5: 135,134,543	D760A	possibly damaging	Het
Muc6	T	C	7: 141,637,474	T2429A	possibly damaging	Het
N4bp2l2	A	G	5: 150,643,250	C134R	unknown	Het
Nanos1	A	G	19: 60,756,534	E90G	probably benign	Het
Nckap1	T	C	2: 80,541,499	D329G	probably damaging	Het
Olfr112	A	C	17: 37,564,221	L30R	probably damaging	Het
Olfr46	T	C	7: 140,610,772	I194T	probably benign	Het
Olfr876	T	C	9: 37,804,576	S222P	probably damaging	Het
Olfr919	G	T	9: 38,698,271	L32I	probably benign	Het
Osbpl7	A	G	11: 97,056,128	H419R	probably benign	Het
Otog	C	T	7: 46,285,776	T1395I	probably benign	Het
Pigq	T	A	17: 25,931,726	I451F	probably benign	Het
Ptgfrn	A	G	3: 101,077,132	V248A	possibly damaging	Het
Rdh19	G	T	10: 127,856,871	V136L	probably damaging	Het
Rfesd	T	C	13: 76,008,189	T33A	possibly damaging	Het
Rnf213	G	A	11: 119,411,545	V432M		Het
Rpl22l1	T	A	3: 28,806,813	L60Q	probably benign	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,920		probably benign	Het
Samd3	A	G	10: 26,244,527	T140A	probably benign	Het
Sbf1	A	G	15: 89,305,420	V419A	possibly damaging	Het
Serpinb6a	T	C	13: 33,935,565		probably null	Het
Slc22a4	A	G	11: 53,990,650	L414P	probably damaging	Het
Smarcd3	A	T	5: 24,593,262	V420D	probably benign	Het
Tcaim	A	G	9: 122,834,930	D495G	probably damaging	Het
Tcrg-C2	A	T	13: 19,307,220		probably benign	Het
Tep1	A	G	14: 50,836,809	V1873A	possibly damaging	Het
Tmcc2	T	C	1: 132,360,789	N387D	probably damaging	Het
Tmed8	A	T	12: 87,172,430	I322N	probably damaging	Het
Tmod4	A	C	3: 95,127,604	D168A	probably benign	Het
Trp53bp1	C	T	2: 121,205,061	E1520K	probably damaging	Het
Trpv5	T	A	6: 41,674,933	I183F	probably damaging	Het
Vmn2r70	A	T	7: 85,559,193	I692K	probably benign	Het
Vmn2r87	T	A	10: 130,479,810	Y129F	probably benign	Het
Vps8	A	G	16: 21,459,751	D253G	probably damaging	Het
Ythdc2	T	C	18: 44,844,286	I383T	possibly damaging	Het
Ythdc2	T	C	18: 44,850,424	S553P	probably benign	Het
Zfyve26	A	G	12: 79,280,355		probably null	Het
Zic1	G	A	9: 91,364,971	T16I	probably damaging	Het

Other mutations in Cmya5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00489:Cmya5	APN	13	93093120	missense	probably benign	0.13
IGL00516:Cmya5	APN	13	93098167	missense	possibly damaging	0.73
IGL00654:Cmya5	APN	13	93094161	missense	probably benign	0.00
IGL00948:Cmya5	APN	13	93091036	missense	probably benign
IGL00966:Cmya5	APN	13	93097906	missense	probably benign	0.33
IGL00988:Cmya5	APN	13	93097933	missense	possibly damaging	0.96
IGL01106:Cmya5	APN	13	93084612	missense	probably damaging	1.00
IGL01331:Cmya5	APN	13	93096946	missense	possibly damaging	0.53
IGL01392:Cmya5	APN	13	93089206	missense	probably damaging	0.99
IGL01508:Cmya5	APN	13	93094027	missense	probably benign
IGL01679:Cmya5	APN	13	93065320	missense	probably damaging	1.00
IGL01749:Cmya5	APN	13	93089299	missense	probably benign	0.00
IGL01861:Cmya5	APN	13	93089748	missense	probably damaging	1.00
IGL02021:Cmya5	APN	13	93094549	missense	probably benign	0.00
IGL02034:Cmya5	APN	13	93084535	splice site	probably benign
IGL02103:Cmya5	APN	13	93092127	missense	probably benign	0.05
IGL02174:Cmya5	APN	13	93048907	missense	possibly damaging	0.76
IGL02176:Cmya5	APN	13	93090150	missense	probably damaging	1.00
IGL02210:Cmya5	APN	13	93092734	missense	probably benign	0.14
IGL02229:Cmya5	APN	13	93092686	missense	possibly damaging	0.54
IGL02306:Cmya5	APN	13	93098019	missense	probably damaging	1.00
IGL02311:Cmya5	APN	13	93090655	missense	probably benign	0.40
IGL02409:Cmya5	APN	13	93090198	missense	probably damaging	0.96
IGL02561:Cmya5	APN	13	93091858	missense	probably benign	0.00
IGL02676:Cmya5	APN	13	93092853	missense	probably damaging	1.00
IGL02683:Cmya5	APN	13	93090997	nonsense	probably null
IGL02685:Cmya5	APN	13	93090997	nonsense	probably null
IGL02686:Cmya5	APN	13	93090997	nonsense	probably null
IGL02724:Cmya5	APN	13	93096655	missense	probably benign
IGL02727:Cmya5	APN	13	93098245	missense	possibly damaging	0.73
IGL02965:Cmya5	APN	13	93092557	missense	probably benign	0.41
IGL03079:Cmya5	APN	13	93097701	missense	possibly damaging	0.85
IGL03144:Cmya5	APN	13	93090868	missense	probably damaging	1.00
IGL03253:Cmya5	APN	13	93091270	nonsense	probably null
IGL03336:Cmya5	APN	13	93093505	missense	possibly damaging	0.84
IGL03138:Cmya5	UTSW	13	93065342	missense	probably damaging	1.00
P0023:Cmya5	UTSW	13	93089346	missense	probably benign	0.22
P4748:Cmya5	UTSW	13	93074475	splice site	probably benign
R0123:Cmya5	UTSW	13	93095904	missense	possibly damaging	0.84
R0206:Cmya5	UTSW	13	93095557	missense	probably damaging	0.98
R0206:Cmya5	UTSW	13	93095557	missense	probably damaging	0.98
R0242:Cmya5	UTSW	13	93095600	missense	probably benign
R0242:Cmya5	UTSW	13	93095600	missense	probably benign
R0331:Cmya5	UTSW	13	93144403	missense	possibly damaging	0.53
R0363:Cmya5	UTSW	13	93094869	missense	possibly damaging	0.77
R0382:Cmya5	UTSW	13	93092748	missense	probably benign	0.06
R0416:Cmya5	UTSW	13	93089856	missense	probably benign	0.05
R0446:Cmya5	UTSW	13	93093656	missense	probably benign
R0457:Cmya5	UTSW	13	93095587	missense	possibly damaging	0.84
R0673:Cmya5	UTSW	13	93089997	missense	probably damaging	1.00
R0674:Cmya5	UTSW	13	93092791	missense	probably damaging	1.00
R0692:Cmya5	UTSW	13	93093849	nonsense	probably null
R0698:Cmya5	UTSW	13	93095557	missense	probably damaging	0.98
R1227:Cmya5	UTSW	13	93094446	missense	probably damaging	0.99
R1272:Cmya5	UTSW	13	93095112	missense	possibly damaging	0.79
R1335:Cmya5	UTSW	13	93041535	missense	possibly damaging	0.65
R1353:Cmya5	UTSW	13	93041525	missense	probably damaging	1.00
R1354:Cmya5	UTSW	13	93092058	missense	possibly damaging	0.46
R1458:Cmya5	UTSW	13	93065327	missense	probably benign	0.44
R1572:Cmya5	UTSW	13	93094269	missense	possibly damaging	0.61
R1698:Cmya5	UTSW	13	93063519	missense	probably benign	0.27
R1735:Cmya5	UTSW	13	93089789	missense	probably benign	0.11
R1743:Cmya5	UTSW	13	93097317	missense	probably benign	0.33
R1750:Cmya5	UTSW	13	93095663	missense	probably benign
R1827:Cmya5	UTSW	13	93074448	missense	possibly damaging	0.80
R2068:Cmya5	UTSW	13	93090524	missense	possibly damaging	0.93
R2088:Cmya5	UTSW	13	93092812	missense	probably damaging	1.00
R2132:Cmya5	UTSW	13	93069383	missense	probably damaging	1.00
R2216:Cmya5	UTSW	13	93093495	missense	probably damaging	1.00
R2363:Cmya5	UTSW	13	93093702	missense	probably benign	0.15
R2497:Cmya5	UTSW	13	93098005	missense	possibly damaging	0.53
R2509:Cmya5	UTSW	13	93093558	missense	probably benign	0.41
R2917:Cmya5	UTSW	13	93091064	nonsense	probably null
R2944:Cmya5	UTSW	13	93092842	nonsense	probably null
R3039:Cmya5	UTSW	13	93092250	missense	probably benign	0.12
R3078:Cmya5	UTSW	13	93048927	missense	probably damaging	0.99
R3708:Cmya5	UTSW	13	93095366	nonsense	probably null
R3717:Cmya5	UTSW	13	93092487	missense	probably benign	0.12
R3768:Cmya5	UTSW	13	93096693	missense	possibly damaging	0.73
R3769:Cmya5	UTSW	13	93096693	missense	possibly damaging	0.73
R3840:Cmya5	UTSW	13	93094632	missense	probably damaging	0.96
R3841:Cmya5	UTSW	13	93094632	missense	probably damaging	0.96
R3882:Cmya5	UTSW	13	93091219	missense	probably benign	0.07
R3888:Cmya5	UTSW	13	93093656	missense	probably benign
R3897:Cmya5	UTSW	13	93096681	missense	possibly damaging	0.72
R3952:Cmya5	UTSW	13	93089199	missense	possibly damaging	0.89
R4366:Cmya5	UTSW	13	93091956	missense	probably benign	0.36
R4471:Cmya5	UTSW	13	93092325	missense	probably benign	0.01
R4493:Cmya5	UTSW	13	93094065	missense	probably benign
R4495:Cmya5	UTSW	13	93094065	missense	probably benign
R4544:Cmya5	UTSW	13	93091918	nonsense	probably null
R4545:Cmya5	UTSW	13	93091918	nonsense	probably null
R4624:Cmya5	UTSW	13	93063551	missense	probably damaging	1.00
R4648:Cmya5	UTSW	13	93093828	missense	possibly damaging	0.84
R4824:Cmya5	UTSW	13	93093574	missense	probably benign	0.04
R4965:Cmya5	UTSW	13	93095787	missense	possibly damaging	0.84
R4967:Cmya5	UTSW	13	93090585	missense	probably damaging	1.00
R5101:Cmya5	UTSW	13	93091603	missense	possibly damaging	0.61
R5133:Cmya5	UTSW	13	93093372	missense	possibly damaging	0.79
R5139:Cmya5	UTSW	13	93096061	missense	probably benign	0.00
R5220:Cmya5	UTSW	13	93092296	missense	probably damaging	0.99
R5332:Cmya5	UTSW	13	93096195	missense	probably damaging	0.96
R5337:Cmya5	UTSW	13	93083273	missense	probably benign	0.28
R5356:Cmya5	UTSW	13	93063485	missense	probably damaging	1.00
R5401:Cmya5	UTSW	13	93091968	missense	probably damaging	1.00
R5438:Cmya5	UTSW	13	93095199	missense	possibly damaging	0.89
R5604:Cmya5	UTSW	13	93092763	missense	probably benign	0.15
R5628:Cmya5	UTSW	13	93089710	missense	probably damaging	1.00
R5666:Cmya5	UTSW	13	93045949	missense	possibly damaging	0.75
R5687:Cmya5	UTSW	13	93098176	missense	possibly damaging	0.53
R5695:Cmya5	UTSW	13	93045866	critical splice donor site	probably null
R5806:Cmya5	UTSW	13	93093937	missense	possibly damaging	0.84
R5820:Cmya5	UTSW	13	93092780	missense	probably benign	0.04
R5872:Cmya5	UTSW	13	93097435	missense	probably benign	0.01
R5875:Cmya5	UTSW	13	93095184	missense	probably benign	0.13
R5896:Cmya5	UTSW	13	93045865	critical splice donor site	probably null
R5910:Cmya5	UTSW	13	93092643	missense	probably damaging	0.98
R5969:Cmya5	UTSW	13	93089544	missense	possibly damaging	0.78
R6064:Cmya5	UTSW	13	93089649	missense	probably damaging	1.00
R6081:Cmya5	UTSW	13	93144513	unclassified	probably benign
R6102:Cmya5	UTSW	13	93094231	missense	probably benign
R6117:Cmya5	UTSW	13	93095166	missense	probably damaging	0.98
R6188:Cmya5	UTSW	13	93093444	missense	possibly damaging	0.61
R6188:Cmya5	UTSW	13	93097276	missense	possibly damaging	0.73
R6219:Cmya5	UTSW	13	93094443	missense	probably damaging	1.00
R6229:Cmya5	UTSW	13	93093306	missense	probably benign	0.41
R6346:Cmya5	UTSW	13	93092190	missense	probably damaging	1.00
R6431:Cmya5	UTSW	13	93074464	missense	possibly damaging	0.60
R6436:Cmya5	UTSW	13	93089215	missense	probably damaging	0.98
R6598:Cmya5	UTSW	13	93089808	missense	probably benign	0.05
R6649:Cmya5	UTSW	13	93098025	missense	possibly damaging	0.91
R6652:Cmya5	UTSW	13	93092895	missense	probably benign	0.04
R6652:Cmya5	UTSW	13	93093039	missense	probably damaging	0.99
R6669:Cmya5	UTSW	13	93093259	missense	probably benign	0.03
R6881:Cmya5	UTSW	13	93090292	missense	probably damaging	1.00
R6909:Cmya5	UTSW	13	93091252	missense	probably benign	0.04
R6933:Cmya5	UTSW	13	93095136	missense	probably benign	0.03
R7021:Cmya5	UTSW	13	93093555	missense	possibly damaging	0.62
R7022:Cmya5	UTSW	13	93069278	critical splice donor site	probably null
R7068:Cmya5	UTSW	13	93092697	missense	possibly damaging	0.59
R7087:Cmya5	UTSW	13	93090975	missense	probably benign	0.00
R7088:Cmya5	UTSW	13	93091864	missense	possibly damaging	0.95
R7126:Cmya5	UTSW	13	93089940	missense	probably benign	0.41
R7177:Cmya5	UTSW	13	93095328	missense	probably benign	0.00
R7188:Cmya5	UTSW	13	93046038	missense	probably damaging	1.00
R7217:Cmya5	UTSW	13	93090430	missense	probably damaging	1.00
R7278:Cmya5	UTSW	13	93095700	missense	probably damaging	0.96
R7293:Cmya5	UTSW	13	93092797	missense	possibly damaging	0.90
R7332:Cmya5	UTSW	13	93092553	missense	possibly damaging	0.60
R7375:Cmya5	UTSW	13	93091661	missense	probably damaging	0.97
R7386:Cmya5	UTSW	13	93069323	missense	probably damaging	1.00
R7489:Cmya5	UTSW	13	93091838	missense	possibly damaging	0.87
R7529:Cmya5	UTSW	13	93097434	missense	probably benign	0.02
R7552:Cmya5	UTSW	13	93069312	missense	probably benign	0.41
R7624:Cmya5	UTSW	13	93090357	missense	possibly damaging	0.79
R7637:Cmya5	UTSW	13	93083212	missense	possibly damaging	0.87
R7673:Cmya5	UTSW	13	93094121	missense	probably benign	0.13
R7753:Cmya5	UTSW	13	93098172	missense	probably benign	0.18
R7757:Cmya5	UTSW	13	93098272	missense	possibly damaging	0.53
R7825:Cmya5	UTSW	13	93097628	missense	possibly damaging	0.53
R7878:Cmya5	UTSW	13	93089757	missense	probably damaging	0.98
R7892:Cmya5	UTSW	13	93096357	missense	probably damaging	0.96
R7952:Cmya5	UTSW	13	93097004	small deletion	probably benign
R8127:Cmya5	UTSW	13	93094614	missense	probably damaging	0.99
R8256:Cmya5	UTSW	13	93093478	missense	possibly damaging	0.62
R8339:Cmya5	UTSW	13	93091634	nonsense	probably null
R8446:Cmya5	UTSW	13	93093828	missense	possibly damaging	0.84
R8553:Cmya5	UTSW	13	93093796	missense	probably benign	0.00
R8686:Cmya5	UTSW	13	93095380	missense	possibly damaging	0.91
R8748:Cmya5	UTSW	13	93089721	missense	probably damaging	1.00
R8783:Cmya5	UTSW	13	93089380	missense	possibly damaging	0.58
R8803:Cmya5	UTSW	13	93041483	missense	probably damaging	1.00
R8810:Cmya5	UTSW	13	93063540	missense	possibly damaging	0.47
R8937:Cmya5	UTSW	13	93096332	missense	probably benign	0.01
R8985:Cmya5	UTSW	13	93097156	missense	possibly damaging	0.73
R9017:Cmya5	UTSW	13	93092064	missense	probably benign	0.03
R9087:Cmya5	UTSW	13	93097203	missense	possibly damaging	0.72
R9133:Cmya5	UTSW	13	93097600	missense	possibly damaging	0.73
R9156:Cmya5	UTSW	13	93097370	missense	unknown
R9209:Cmya5	UTSW	13	93090358	missense	probably benign	0.45
R9222:Cmya5	UTSW	13	93094071	missense	probably benign	0.00
R9229:Cmya5	UTSW	13	93095668	missense	possibly damaging	0.92
R9382:Cmya5	UTSW	13	93093376	missense	probably benign
R9385:Cmya5	UTSW	13	93094372	missense	probably damaging	0.99
R9418:Cmya5	UTSW	13	93089701	missense	probably benign	0.22
R9452:Cmya5	UTSW	13	93095886	missense	probably benign
R9492:Cmya5	UTSW	13	93041314	makesense	probably null
R9600:Cmya5	UTSW	13	93090096	missense	probably damaging	1.00
R9712:Cmya5	UTSW	13	93065373	critical splice acceptor site	probably null
R9742:Cmya5	UTSW	13	93095427	missense	possibly damaging	0.89
RF020:Cmya5	UTSW	13	93069291	missense	possibly damaging	0.56
X0028:Cmya5	UTSW	13	93096687	missense	possibly damaging	0.53
Z1088:Cmya5	UTSW	13	93063579	missense	probably benign
Z1176:Cmya5	UTSW	13	93063579	missense	probably benign
Z1176:Cmya5	UTSW	13	93096790	missense	unknown
Z1177:Cmya5	UTSW	13	93063579	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CATGCTGGGCAAAGGCAAAC -3'
(R):5'- AGAATGTTGTCAAAGAATGAGCCTG -3'

Sequencing Primer
(F):5'- ACTCCCTTTAAGCCTGGGTG -3'
(R):5'- TGTTGTCAAAGAATGAGCCTGAAGTG -3'

Posted On

2019-11-26