Incidental Mutation 'R7806:Ythdc2'
ID600827
Institutional Source Beutler Lab
Gene Symbol Ythdc2
Ensembl Gene ENSMUSG00000034653
Gene NameYTH domain containing 2
Synonyms3010002F02Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7806 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location44827746-44889724 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44850424 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 553 (S553P)
Ref Sequence ENSEMBL: ENSMUSP00000048340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037763] [ENSMUST00000201507]
Predicted Effect probably benign
Transcript: ENSMUST00000037763
AA Change: S553P

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000048340
Gene: ENSMUSG00000034653
AA Change: S553P

DomainStartEndE-ValueType
low complexity region 2 50 N/A INTRINSIC
Pfam:R3H 59 119 1.7e-15 PFAM
DEXDc 206 393 4.95e-26 SMART
low complexity region 413 428 N/A INTRINSIC
ANK 521 550 2.79e1 SMART
ANK 554 583 1.5e2 SMART
HELICc 648 759 5.31e-17 SMART
HA2 823 916 2.58e-22 SMART
Pfam:OB_NTP_bind 953 1082 1.3e-18 PFAM
low complexity region 1263 1299 N/A INTRINSIC
Pfam:YTH 1303 1434 7.2e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201507
SMART Domains Protein: ENSMUSP00000144479
Gene: ENSMUSG00000034653

DomainStartEndE-ValueType
HELICc 5 104 9.1e-19 SMART
HA2 168 261 2e-26 SMART
Pfam:OB_NTP_bind 298 427 6e-16 PFAM
low complexity region 570 582 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (83/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAH (Asp-Glu-Ala-His) subfamily of proteins, part of the DEAD (Asp-Glu-Ala-Asp) box family of RNA helicases. The encoded protein binds to N6-methyladenosine, a common modified RNA nucleotide that is enriched in the stop codons and 3' UTRs of eukaryotic messenger RNAs. Binding of proteins to this modified nucleotide may regulate mRNA translation and stability. This gene may be associated with susceptibility to pancreatic cancer in human patients, and knockdown of this gene resulted in reduced proliferation in a human liver cancer cell line. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit female and male infertility with arrested meiosis and small gonads. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik C A 8: 124,842,404 V144F probably benign Het
Aar2 T A 2: 156,551,111 I140N possibly damaging Het
Abca15 A G 7: 120,332,836 N104S probably damaging Het
Adam22 A T 5: 8,092,825 N803K probably damaging Het
Adk A G 14: 21,326,611 N26S Het
Ak9 A C 10: 41,433,084 probably null Het
Alpk2 T C 18: 65,349,416 D40G probably benign Het
Ankrd65 A T 4: 155,792,980 H316L probably benign Het
Cabp7 C T 11: 4,738,889 A194T probably damaging Het
Ccdc180 A C 4: 45,912,801 K593N possibly damaging Het
Cd80 A G 16: 38,473,953 D66G probably benign Het
Cdh5 T C 8: 104,140,816 V575A probably damaging Het
Cep350 T C 1: 155,862,063 Q2678R probably benign Het
Cideb G A 14: 55,755,168 T97M probably damaging Het
Clca4b T C 3: 144,932,396 D35G probably benign Het
Clpx T C 9: 65,299,931 V37A probably benign Het
Cmya5 A C 13: 93,094,262 S1439R probably benign Het
Cndp2 T A 18: 84,670,820 H279L probably benign Het
Cngb1 A T 8: 95,298,804 probably null Het
Cpq T A 15: 33,497,297 N394K possibly damaging Het
Dedd T C 1: 171,338,494 L60P probably benign Het
Dennd3 C A 15: 73,570,775 L1216M possibly damaging Het
Dntt A T 19: 41,029,632 N65I probably benign Het
Fap T A 2: 62,503,414 E662V probably damaging Het
Fasn A T 11: 120,809,995 M2066K probably benign Het
Fggy G A 4: 95,600,966 G69E probably benign Het
Foxc1 G T 13: 31,808,756 G517C unknown Het
Gas2l3 A G 10: 89,413,370 Y629H probably benign Het
Gcnt2 A G 13: 40,918,241 N120S probably damaging Het
Gfpt2 A G 11: 49,823,315 T300A probably benign Het
Glud1 A G 14: 34,343,649 R535G probably damaging Het
Gm3248 T A 14: 5,943,883 I114L probably benign Het
Gm3278 G A 14: 4,895,172 probably null Het
Gm3402 A C 5: 146,514,280 K44Q probably damaging Het
Gm3696 C G 14: 7,087,893 R188S probably benign Het
Gm3696 C A 14: 7,087,894 R188M probably benign Het
Gmppa T C 1: 75,438,937 L113P probably damaging Het
Gmps A G 3: 63,982,670 probably null Het
Gnal T A 18: 67,213,074 M275K probably damaging Het
Gopc G C 10: 52,353,429 N231K probably damaging Het
Gpr152 T C 19: 4,143,488 S343P probably benign Het
Gpr17 T C 18: 31,947,540 I157V probably benign Het
Grm7 T A 6: 111,246,353 Y451* probably null Het
Ikbke T C 1: 131,271,898 E286G probably damaging Het
Inpp5b A T 4: 124,785,088 probably null Het
Iqgap2 G A 13: 95,682,257 L664F probably benign Het
Kif17 A G 4: 138,288,196 E552G possibly damaging Het
Lamtor1 T A 7: 101,906,013 Y5* probably null Het
Lpin2 A G 17: 71,245,171 I829V probably damaging Het
Lrg1 T G 17: 56,119,967 D335A probably benign Het
Lrriq3 T C 3: 155,098,807 Y35H probably damaging Het
Mkx T A 18: 7,000,607 M112L probably benign Het
Mlxipl A C 5: 135,134,543 D760A possibly damaging Het
Muc6 T C 7: 141,637,474 T2429A possibly damaging Het
N4bp2l2 A G 5: 150,643,250 C134R unknown Het
Nanos1 A G 19: 60,756,534 E90G probably benign Het
Nckap1 T C 2: 80,541,499 D329G probably damaging Het
Olfr112 A C 17: 37,564,221 L30R probably damaging Het
Olfr46 T C 7: 140,610,772 I194T probably benign Het
Olfr876 T C 9: 37,804,576 S222P probably damaging Het
Olfr919 G T 9: 38,698,271 L32I probably benign Het
Osbpl7 A G 11: 97,056,128 H419R probably benign Het
Otog C T 7: 46,285,776 T1395I probably benign Het
Pigq T A 17: 25,931,726 I451F probably benign Het
Ptgfrn A G 3: 101,077,132 V248A possibly damaging Het
Rdh19 G T 10: 127,856,871 V136L probably damaging Het
Rfesd T C 13: 76,008,189 T33A possibly damaging Het
Rnf213 G A 11: 119,411,545 V432M Het
Rpl22l1 T A 3: 28,806,813 L60Q probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,920 probably benign Het
Samd3 A G 10: 26,244,527 T140A probably benign Het
Sbf1 A G 15: 89,305,420 V419A possibly damaging Het
Serpinb6a T C 13: 33,935,565 probably null Het
Slc22a4 A G 11: 53,990,650 L414P probably damaging Het
Smarcd3 A T 5: 24,593,262 V420D probably benign Het
Tcaim A G 9: 122,834,930 D495G probably damaging Het
Tcrg-C2 A T 13: 19,307,220 probably benign Het
Tep1 A G 14: 50,836,809 V1873A possibly damaging Het
Tmcc2 T C 1: 132,360,789 N387D probably damaging Het
Tmed8 A T 12: 87,172,430 I322N probably damaging Het
Tmod4 A C 3: 95,127,604 D168A probably benign Het
Trp53bp1 C T 2: 121,205,061 E1520K probably damaging Het
Trpv5 T A 6: 41,674,933 I183F probably damaging Het
Vmn2r70 A T 7: 85,559,193 I692K probably benign Het
Vmn2r87 T A 10: 130,479,810 Y129F probably benign Het
Vps8 A G 16: 21,459,751 D253G probably damaging Het
Zfyve26 A G 12: 79,280,355 probably null Het
Zic1 G A 9: 91,364,971 T16I probably damaging Het
Other mutations in Ythdc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Ythdc2 APN 18 44859973 missense probably benign
IGL00341:Ythdc2 APN 18 44850397 missense probably benign 0.00
IGL00502:Ythdc2 APN 18 44847812 missense probably damaging 0.99
IGL00585:Ythdc2 APN 18 44864361 missense probably damaging 1.00
IGL01081:Ythdc2 APN 18 44850659 missense probably benign 0.19
IGL01569:Ythdc2 APN 18 44887651 missense probably benign
IGL01577:Ythdc2 APN 18 44858282 missense probably benign 0.00
IGL01617:Ythdc2 APN 18 44841415 missense possibly damaging 0.53
IGL01674:Ythdc2 APN 18 44860404 missense probably benign 0.04
IGL01736:Ythdc2 APN 18 44850668 missense probably damaging 0.97
IGL02095:Ythdc2 APN 18 44873140 splice site probably benign
IGL02245:Ythdc2 APN 18 44862684 missense possibly damaging 0.74
IGL02524:Ythdc2 APN 18 44847854 missense probably damaging 0.98
IGL02542:Ythdc2 APN 18 44840241 missense probably damaging 1.00
IGL02622:Ythdc2 APN 18 44859934 missense probably damaging 0.99
IGL02795:Ythdc2 APN 18 44837438 missense possibly damaging 0.95
IGL02935:Ythdc2 APN 18 44855045 missense probably damaging 1.00
PIT4618001:Ythdc2 UTSW 18 44834598 missense probably benign 0.19
R0115:Ythdc2 UTSW 18 44841423 splice site probably benign
R0329:Ythdc2 UTSW 18 44865060 splice site probably benign
R0472:Ythdc2 UTSW 18 44864357 missense probably benign 0.02
R0530:Ythdc2 UTSW 18 44850398 missense probably damaging 0.99
R0547:Ythdc2 UTSW 18 44840264 missense possibly damaging 0.92
R0563:Ythdc2 UTSW 18 44864848 splice site probably benign
R0609:Ythdc2 UTSW 18 44864357 missense probably benign 0.02
R1291:Ythdc2 UTSW 18 44855209 missense probably benign 0.33
R1469:Ythdc2 UTSW 18 44864462 missense probably benign 0.00
R1469:Ythdc2 UTSW 18 44864462 missense probably benign 0.00
R1724:Ythdc2 UTSW 18 44828690 missense probably benign 0.04
R1860:Ythdc2 UTSW 18 44872956 missense possibly damaging 0.86
R2040:Ythdc2 UTSW 18 44855174 nonsense probably null
R2308:Ythdc2 UTSW 18 44847748 missense possibly damaging 0.95
R3711:Ythdc2 UTSW 18 44833173 missense probably damaging 0.98
R4005:Ythdc2 UTSW 18 44833128 missense probably benign 0.00
R4580:Ythdc2 UTSW 18 44858198 missense possibly damaging 0.81
R4631:Ythdc2 UTSW 18 44887631 missense probably benign 0.03
R4815:Ythdc2 UTSW 18 44885240 missense probably benign 0.40
R4924:Ythdc2 UTSW 18 44847804 missense probably damaging 1.00
R4982:Ythdc2 UTSW 18 44871465 missense probably benign 0.01
R5011:Ythdc2 UTSW 18 44854742 missense probably benign 0.38
R5141:Ythdc2 UTSW 18 44865047 missense probably benign 0.01
R5147:Ythdc2 UTSW 18 44844292 missense probably damaging 0.98
R5280:Ythdc2 UTSW 18 44860621 missense probably damaging 1.00
R5388:Ythdc2 UTSW 18 44857025 missense possibly damaging 0.65
R5928:Ythdc2 UTSW 18 44833205 missense probably benign
R5931:Ythdc2 UTSW 18 44872956 missense possibly damaging 0.86
R5995:Ythdc2 UTSW 18 44886253 missense probably damaging 1.00
R6027:Ythdc2 UTSW 18 44860436 missense probably benign 0.02
R6056:Ythdc2 UTSW 18 44840210 missense probably damaging 0.98
R6318:Ythdc2 UTSW 18 44860377 missense probably benign 0.04
R6399:Ythdc2 UTSW 18 44886402 missense possibly damaging 0.93
R6586:Ythdc2 UTSW 18 44845788 missense probably benign 0.00
R6684:Ythdc2 UTSW 18 44873069 missense possibly damaging 0.47
R7040:Ythdc2 UTSW 18 44834462 missense probably benign 0.02
R7071:Ythdc2 UTSW 18 44845788 missense probably benign 0.00
R7105:Ythdc2 UTSW 18 44834563 missense probably damaging 1.00
R7148:Ythdc2 UTSW 18 44833122 missense probably benign 0.42
R7290:Ythdc2 UTSW 18 44837491 missense possibly damaging 0.50
R7806:Ythdc2 UTSW 18 44844286 missense possibly damaging 0.91
R8114:Ythdc2 UTSW 18 44877740 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- ACCAGTCACAGTTAATTGTGTAGTC -3'
(R):5'- TTAGCCCAATCTAAAGCCATCCTG -3'

Sequencing Primer
(F):5'- GTCACAGTTAATTGTGTAGTCAGTTC -3'
(R):5'- TCTAAAGCCATCCTGCAAATTTC -3'
Posted On2019-11-26