Incidental Mutation 'R7807:Serpinb8'
ID600837
Institutional Source Beutler Lab
Gene Symbol Serpinb8
Ensembl Gene ENSMUSG00000026315
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 8
SynonymsCAP2, Spi8, CAP-2, NK10, ovalbumin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R7807 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location107590006-107610484 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 107604727 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 183 (M183K)
Ref Sequence ENSEMBL: ENSMUSP00000000514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000514] [ENSMUST00000112706] [ENSMUST00000123086]
Predicted Effect probably damaging
Transcript: ENSMUST00000000514
AA Change: M183K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000000514
Gene: ENSMUSG00000026315
AA Change: M183K

DomainStartEndE-ValueType
SERPIN 13 374 1.69e-177 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112706
AA Change: M183K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108326
Gene: ENSMUSG00000026315
AA Change: M183K

DomainStartEndE-ValueType
SERPIN 13 374 1.69e-177 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123086
Meta Mutation Damage Score 0.2948 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the ov-serpin family of serine protease inhibitors. The encoded protein is produced by platelets and can bind to and inhibit the function of furin, a serine protease involved in platelet functions. In addition, this protein has been found to enhance the mechanical stability of cell-cell adhesion in the skin, and defects in this gene have been associated with an autosomal-recessive form of exfoliative ichthyosis. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik T C 2: 130,710,865 K1092E probably damaging Het
AB124611 C A 9: 21,535,980 T146K probably benign Het
Alms1 T A 6: 85,622,976 S1595T possibly damaging Het
Ankrd44 A T 1: 54,792,476 I56N probably damaging Het
Anln C A 9: 22,360,880 V648F probably damaging Het
Arhgap29 A G 3: 122,014,332 D1053G probably benign Het
Baalc T C 15: 38,934,017 S68P probably benign Het
Begain T C 12: 109,038,930 D52G probably damaging Het
Blmh A G 11: 76,946,214 I41V probably benign Het
Bpifc T A 10: 85,976,250 I365F possibly damaging Het
C2 G T 17: 34,876,371 S199R possibly damaging Het
Ccbe1 T A 18: 66,066,757 H298L probably damaging Het
Ccdc112 T A 18: 46,290,759 K304I probably damaging Het
Ccdc15 T C 9: 37,315,382 E432G probably benign Het
Cdh13 T A 8: 118,283,855 M1K probably null Het
Cipc T C 12: 86,962,125 S253P possibly damaging Het
Clcn1 A G 6: 42,310,348 probably null Het
Clock A T 5: 76,243,135 N273K probably benign Het
Cyp19a1 T C 9: 54,166,842 D476G probably benign Het
Dnah7b A G 1: 46,214,367 I1811V probably benign Het
Fat1 C A 8: 45,041,973 T4091K probably damaging Het
Gm10340 T A 14: 3,134,925 N64K probably damaging Het
Gm12394 A C 4: 42,793,885 H82Q probably benign Het
Hectd1 G A 12: 51,745,388 R2523C probably damaging Het
Hgf A G 5: 16,577,011 H244R probably damaging Het
Hgs G T 11: 120,479,934 A567S probably damaging Het
Igdcc4 T C 9: 65,133,795 V1036A probably benign Het
Keg1 G A 19: 12,714,634 probably null Het
Klhl8 A T 5: 103,876,066 L156Q probably damaging Het
Lmln T C 16: 33,107,131 Y521H probably benign Het
Lrrc7 A G 3: 158,160,487 S1206P probably damaging Het
Mad1l1 T A 5: 140,088,786 I550F probably benign Het
Marf1 C T 16: 14,153,889 W28* probably null Het
Mfsd11 T G 11: 116,863,907 S215A probably benign Het
Mpped2 C A 2: 106,744,740 H57N possibly damaging Het
Mslnl A G 17: 25,746,777 M542V probably benign Het
Myh6 G T 14: 54,942,440 H1903Q probably damaging Het
Neo1 T C 9: 58,990,494 T60A probably benign Het
Npm2 T A 14: 70,652,507 probably null Het
Olfr1165-ps T C 2: 88,101,565 S141G probably benign Het
Olfr1355 T A 10: 78,879,209 S12R probably benign Het
Olfr1487 C A 19: 13,619,921 T210K probably damaging Het
Pax9 A T 12: 56,697,065 I166F possibly damaging Het
Pcsk9 A G 4: 106,463,895 S6P possibly damaging Het
Pikfyve A G 1: 65,269,942 Y1893C probably damaging Het
Pirb T C 7: 3,719,865 T43A possibly damaging Het
Pou3f1 A G 4: 124,658,281 D192G possibly damaging Het
Pus3 C G 9: 35,566,725 R418G probably damaging Het
Rexo1 C T 10: 80,550,136 V363I probably benign Het
Sdcbp A G 4: 6,393,688 T269A probably damaging Het
Sele T C 1: 164,053,893 V523A probably benign Het
Sh2d4a T G 8: 68,282,381 S51A probably benign Het
Siglec15 A G 18: 78,047,481 S201P probably damaging Het
Slc10a5 C T 3: 10,335,469 V44I probably benign Het
Slc16a13 A G 11: 70,220,562 V39A probably damaging Het
Slc25a13 G A 6: 6,117,164 R184W probably damaging Het
Slc35f5 T A 1: 125,584,541 D359E probably damaging Het
Slc3a1 A G 17: 85,063,943 E641G probably benign Het
Slf1 T C 13: 77,046,704 D834G probably damaging Het
Stim1 T C 7: 102,427,141 I433T probably damaging Het
Stra6 T A 9: 58,150,161 I418K probably damaging Het
Tanc2 A G 11: 105,867,654 N747S probably benign Het
Tet2 T C 3: 133,486,541 T711A possibly damaging Het
Trpm6 T C 19: 18,829,856 I988T probably benign Het
Ttc41 T A 10: 86,776,631 I1256N probably benign Het
Uba2 T C 7: 34,163,213 D100G possibly damaging Het
Vmn1r43 A G 6: 89,870,237 I89T probably benign Het
Vmn2r58 T A 7: 41,872,486 Y62F probably benign Het
Ylpm1 C T 12: 85,014,081 Q428* probably null Het
Zcrb1 T C 15: 93,391,121 D88G probably damaging Het
Zmym1 A C 4: 127,047,874 I907S probably damaging Het
Other mutations in Serpinb8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Serpinb8 APN 1 107606984 missense probably benign 0.01
IGL01309:Serpinb8 APN 1 107604718 missense probably damaging 1.00
IGL03210:Serpinb8 APN 1 107602911 missense probably damaging 1.00
Hachi UTSW 1 107597471 start codon destroyed probably null 1.00
BB002:Serpinb8 UTSW 1 107598985 missense probably benign 0.25
BB012:Serpinb8 UTSW 1 107598985 missense probably benign 0.25
IGL02835:Serpinb8 UTSW 1 107602856 missense probably damaging 1.00
R0284:Serpinb8 UTSW 1 107602918 critical splice donor site probably null
R1087:Serpinb8 UTSW 1 107606997 missense probably damaging 0.99
R1728:Serpinb8 UTSW 1 107597527 missense probably benign
R1728:Serpinb8 UTSW 1 107598954 missense probably benign
R1728:Serpinb8 UTSW 1 107607004 missense probably benign 0.02
R1729:Serpinb8 UTSW 1 107597527 missense probably benign
R1729:Serpinb8 UTSW 1 107598954 missense probably benign
R1729:Serpinb8 UTSW 1 107607004 missense probably benign 0.02
R1730:Serpinb8 UTSW 1 107597527 missense probably benign
R1730:Serpinb8 UTSW 1 107598954 missense probably benign
R1730:Serpinb8 UTSW 1 107607004 missense probably benign 0.02
R1739:Serpinb8 UTSW 1 107597527 missense probably benign
R1739:Serpinb8 UTSW 1 107598954 missense probably benign
R1739:Serpinb8 UTSW 1 107607004 missense probably benign 0.02
R1762:Serpinb8 UTSW 1 107597527 missense probably benign
R1762:Serpinb8 UTSW 1 107598954 missense probably benign
R1762:Serpinb8 UTSW 1 107607004 missense probably benign 0.02
R1783:Serpinb8 UTSW 1 107597527 missense probably benign
R1783:Serpinb8 UTSW 1 107598954 missense probably benign
R1783:Serpinb8 UTSW 1 107607004 missense probably benign 0.02
R1785:Serpinb8 UTSW 1 107597527 missense probably benign
R1785:Serpinb8 UTSW 1 107598954 missense probably benign
R1785:Serpinb8 UTSW 1 107607004 missense probably benign 0.02
R2120:Serpinb8 UTSW 1 107605887 missense probably damaging 1.00
R2146:Serpinb8 UTSW 1 107605927 missense probably benign 0.11
R2148:Serpinb8 UTSW 1 107605927 missense probably benign 0.11
R2391:Serpinb8 UTSW 1 107607069 missense probably damaging 1.00
R2897:Serpinb8 UTSW 1 107607046 missense unknown
R2898:Serpinb8 UTSW 1 107607046 missense unknown
R3114:Serpinb8 UTSW 1 107607293 missense probably benign 0.09
R3697:Serpinb8 UTSW 1 107607146 nonsense probably null
R4783:Serpinb8 UTSW 1 107604742 missense probably benign 0.05
R5225:Serpinb8 UTSW 1 107597471 start codon destroyed probably null 1.00
R5412:Serpinb8 UTSW 1 107605886 missense probably benign 0.39
R5525:Serpinb8 UTSW 1 107607293 missense probably damaging 0.99
R5554:Serpinb8 UTSW 1 107598975 missense probably benign 0.01
R5891:Serpinb8 UTSW 1 107605845 missense probably damaging 0.98
R6594:Serpinb8 UTSW 1 107597471 start codon destroyed probably null 1.00
R6681:Serpinb8 UTSW 1 107597591 missense probably damaging 1.00
R7127:Serpinb8 UTSW 1 107597470 start codon destroyed probably null 1.00
R7151:Serpinb8 UTSW 1 107605797 missense probably damaging 1.00
R7300:Serpinb8 UTSW 1 107607323 makesense probably null
R7716:Serpinb8 UTSW 1 107604708 nonsense probably null
R7822:Serpinb8 UTSW 1 107606993 nonsense probably null
R7925:Serpinb8 UTSW 1 107598985 missense probably benign 0.25
R8210:Serpinb8 UTSW 1 107599006 missense probably damaging 1.00
X0018:Serpinb8 UTSW 1 107597597 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTCGTCTCCCAAATCAGTATAGG -3'
(R):5'- ACAGCTCAAGCAGGGTTTTAC -3'

Sequencing Primer
(F):5'- CCAAATCAGTATAGGCTTCTCTTAC -3'
(R):5'- GCAGGGTTTTACTCAACAGAGATCC -3'
Posted On2019-11-26