Mutagenetix > Incidental Mutations

Incidental Mutation 'R7807:Serpinb8'

600837

Institutional Source

Beutler Lab

Gene Symbol

Serpinb8

Ensembl Gene

ENSMUSG00000026315

Gene Name

serine (or cysteine) peptidase inhibitor, clade B, member 8

Synonyms

CAP2, Spi8, CAP-2, NK10, ovalbumin

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.057) question?

Stock #

R7807 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

107590006-107610484 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 107604727 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 183 (M183K)

Ref Sequence

ENSEMBL: ENSMUSP00000000514 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000514] [ENSMUST00000112706] [ENSMUST00000123086]

Predicted Effect

probably damaging
Transcript: ENSMUST00000000514
AA Change: M183K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000000514
Gene: ENSMUSG00000026315
AA Change: M183K

Domain	Start	End	E-Value	Type
SERPIN	13	374	1.69e-177	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000112706
AA Change: M183K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000108326
Gene: ENSMUSG00000026315
AA Change: M183K

Domain	Start	End	E-Value	Type
SERPIN	13	374	1.69e-177	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000123086

Meta Mutation Damage Score

0.2948

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the ov-serpin family of serine protease inhibitors. The encoded protein is produced by platelets and can bind to and inhibit the function of furin, a serine protease involved in platelet functions. In addition, this protein has been found to enhance the mechanical stability of cell-cell adhesion in the skin, and defects in this gene have been associated with an autosomal-recessive form of exfoliative ichthyosis. [provided by RefSeq, Jan 2017]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	T	C	2: 130,710,865	K1092E	probably damaging	Het
AB124611	C	A	9: 21,535,980	T146K	probably benign	Het
Alms1	T	A	6: 85,622,976	S1595T	possibly damaging	Het
Ankrd44	A	T	1: 54,792,476	I56N	probably damaging	Het
Anln	C	A	9: 22,360,880	V648F	probably damaging	Het
Arhgap29	A	G	3: 122,014,332	D1053G	probably benign	Het
Baalc	T	C	15: 38,934,017	S68P	probably benign	Het
Begain	T	C	12: 109,038,930	D52G	probably damaging	Het
Blmh	A	G	11: 76,946,214	I41V	probably benign	Het
Bpifc	T	A	10: 85,976,250	I365F	possibly damaging	Het
C2	G	T	17: 34,876,371	S199R	possibly damaging	Het
Ccbe1	T	A	18: 66,066,757	H298L	probably damaging	Het
Ccdc112	T	A	18: 46,290,759	K304I	probably damaging	Het
Ccdc15	T	C	9: 37,315,382	E432G	probably benign	Het
Cdh13	T	A	8: 118,283,855	M1K	probably null	Het
Cipc	T	C	12: 86,962,125	S253P	possibly damaging	Het
Clcn1	A	G	6: 42,310,348		probably null	Het
Clock	A	T	5: 76,243,135	N273K	probably benign	Het
Cyp19a1	T	C	9: 54,166,842	D476G	probably benign	Het
Dnah7b	A	G	1: 46,214,367	I1811V	probably benign	Het
Fat1	C	A	8: 45,041,973	T4091K	probably damaging	Het
Gm10340	T	A	14: 3,134,925	N64K	probably damaging	Het
Gm12394	A	C	4: 42,793,885	H82Q	probably benign	Het
Hectd1	G	A	12: 51,745,388	R2523C	probably damaging	Het
Hgf	A	G	5: 16,577,011	H244R	probably damaging	Het
Hgs	G	T	11: 120,479,934	A567S	probably damaging	Het
Igdcc4	T	C	9: 65,133,795	V1036A	probably benign	Het
Keg1	G	A	19: 12,714,634		probably null	Het
Klhl8	A	T	5: 103,876,066	L156Q	probably damaging	Het
Lmln	T	C	16: 33,107,131	Y521H	probably benign	Het
Lrrc7	A	G	3: 158,160,487	S1206P	probably damaging	Het
Mad1l1	T	A	5: 140,088,786	I550F	probably benign	Het
Marf1	C	T	16: 14,153,889	W28*	probably null	Het
Mfsd11	T	G	11: 116,863,907	S215A	probably benign	Het
Mpped2	C	A	2: 106,744,740	H57N	possibly damaging	Het
Mslnl	A	G	17: 25,746,777	M542V	probably benign	Het
Myh6	G	T	14: 54,942,440	H1903Q	probably damaging	Het
Neo1	T	C	9: 58,990,494	T60A	probably benign	Het
Npm2	T	A	14: 70,652,507		probably null	Het
Olfr1165-ps	T	C	2: 88,101,565	S141G	probably benign	Het
Olfr1355	T	A	10: 78,879,209	S12R	probably benign	Het
Olfr1487	C	A	19: 13,619,921	T210K	probably damaging	Het
Pax9	A	T	12: 56,697,065	I166F	possibly damaging	Het
Pcsk9	A	G	4: 106,463,895	S6P	possibly damaging	Het
Pikfyve	A	G	1: 65,269,942	Y1893C	probably damaging	Het
Pirb	T	C	7: 3,719,865	T43A	possibly damaging	Het
Pou3f1	A	G	4: 124,658,281	D192G	possibly damaging	Het
Pus3	C	G	9: 35,566,725	R418G	probably damaging	Het
Rexo1	C	T	10: 80,550,136	V363I	probably benign	Het
Sdcbp	A	G	4: 6,393,688	T269A	probably damaging	Het
Sele	T	C	1: 164,053,893	V523A	probably benign	Het
Sh2d4a	T	G	8: 68,282,381	S51A	probably benign	Het
Siglec15	A	G	18: 78,047,481	S201P	probably damaging	Het
Slc10a5	C	T	3: 10,335,469	V44I	probably benign	Het
Slc16a13	A	G	11: 70,220,562	V39A	probably damaging	Het
Slc25a13	G	A	6: 6,117,164	R184W	probably damaging	Het
Slc35f5	T	A	1: 125,584,541	D359E	probably damaging	Het
Slc3a1	A	G	17: 85,063,943	E641G	probably benign	Het
Slf1	T	C	13: 77,046,704	D834G	probably damaging	Het
Stim1	T	C	7: 102,427,141	I433T	probably damaging	Het
Stra6	T	A	9: 58,150,161	I418K	probably damaging	Het
Tanc2	A	G	11: 105,867,654	N747S	probably benign	Het
Tet2	T	C	3: 133,486,541	T711A	possibly damaging	Het
Trpm6	T	C	19: 18,829,856	I988T	probably benign	Het
Ttc41	T	A	10: 86,776,631	I1256N	probably benign	Het
Uba2	T	C	7: 34,163,213	D100G	possibly damaging	Het
Vmn1r43	A	G	6: 89,870,237	I89T	probably benign	Het
Vmn2r58	T	A	7: 41,872,486	Y62F	probably benign	Het
Ylpm1	C	T	12: 85,014,081	Q428*	probably null	Het
Zcrb1	T	C	15: 93,391,121	D88G	probably damaging	Het
Zmym1	A	C	4: 127,047,874	I907S	probably damaging	Het

Other mutations in Serpinb8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00391:Serpinb8	APN	1	107606984	missense	probably benign	0.01
IGL01309:Serpinb8	APN	1	107604718	missense	probably damaging	1.00
IGL03210:Serpinb8	APN	1	107602911	missense	probably damaging	1.00
Hachi	UTSW	1	107597471	start codon destroyed	probably null	1.00
BB002:Serpinb8	UTSW	1	107598985	missense	probably benign	0.25
BB012:Serpinb8	UTSW	1	107598985	missense	probably benign	0.25
IGL02835:Serpinb8	UTSW	1	107602856	missense	probably damaging	1.00
R0284:Serpinb8	UTSW	1	107602918	critical splice donor site	probably null
R1087:Serpinb8	UTSW	1	107606997	missense	probably damaging	0.99
R1728:Serpinb8	UTSW	1	107597527	missense	probably benign
R1728:Serpinb8	UTSW	1	107598954	missense	probably benign
R1728:Serpinb8	UTSW	1	107607004	missense	probably benign	0.02
R1729:Serpinb8	UTSW	1	107597527	missense	probably benign
R1729:Serpinb8	UTSW	1	107598954	missense	probably benign
R1729:Serpinb8	UTSW	1	107607004	missense	probably benign	0.02
R1730:Serpinb8	UTSW	1	107597527	missense	probably benign
R1730:Serpinb8	UTSW	1	107598954	missense	probably benign
R1730:Serpinb8	UTSW	1	107607004	missense	probably benign	0.02
R1739:Serpinb8	UTSW	1	107597527	missense	probably benign
R1739:Serpinb8	UTSW	1	107598954	missense	probably benign
R1739:Serpinb8	UTSW	1	107607004	missense	probably benign	0.02
R1762:Serpinb8	UTSW	1	107597527	missense	probably benign
R1762:Serpinb8	UTSW	1	107598954	missense	probably benign
R1762:Serpinb8	UTSW	1	107607004	missense	probably benign	0.02
R1783:Serpinb8	UTSW	1	107597527	missense	probably benign
R1783:Serpinb8	UTSW	1	107598954	missense	probably benign
R1783:Serpinb8	UTSW	1	107607004	missense	probably benign	0.02
R1785:Serpinb8	UTSW	1	107597527	missense	probably benign
R1785:Serpinb8	UTSW	1	107598954	missense	probably benign
R1785:Serpinb8	UTSW	1	107607004	missense	probably benign	0.02
R2120:Serpinb8	UTSW	1	107605887	missense	probably damaging	1.00
R2146:Serpinb8	UTSW	1	107605927	missense	probably benign	0.11
R2148:Serpinb8	UTSW	1	107605927	missense	probably benign	0.11
R2391:Serpinb8	UTSW	1	107607069	missense	probably damaging	1.00
R2897:Serpinb8	UTSW	1	107607046	missense	unknown
R2898:Serpinb8	UTSW	1	107607046	missense	unknown
R3114:Serpinb8	UTSW	1	107607293	missense	probably benign	0.09
R3697:Serpinb8	UTSW	1	107607146	nonsense	probably null
R4783:Serpinb8	UTSW	1	107604742	missense	probably benign	0.05
R5225:Serpinb8	UTSW	1	107597471	start codon destroyed	probably null	1.00
R5412:Serpinb8	UTSW	1	107605886	missense	probably benign	0.39
R5525:Serpinb8	UTSW	1	107607293	missense	probably damaging	0.99
R5554:Serpinb8	UTSW	1	107598975	missense	probably benign	0.01
R5891:Serpinb8	UTSW	1	107605845	missense	probably damaging	0.98
R6594:Serpinb8	UTSW	1	107597471	start codon destroyed	probably null	1.00
R6681:Serpinb8	UTSW	1	107597591	missense	probably damaging	1.00
R7127:Serpinb8	UTSW	1	107597470	start codon destroyed	probably null	1.00
R7151:Serpinb8	UTSW	1	107605797	missense	probably damaging	1.00
R7300:Serpinb8	UTSW	1	107607323	makesense	probably null
R7716:Serpinb8	UTSW	1	107604708	nonsense	probably null
R7822:Serpinb8	UTSW	1	107606993	nonsense	probably null
R7925:Serpinb8	UTSW	1	107598985	missense	probably benign	0.25
R8210:Serpinb8	UTSW	1	107599006	missense	probably damaging	1.00
X0018:Serpinb8	UTSW	1	107597597	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CTCGTCTCCCAAATCAGTATAGG -3'
(R):5'- ACAGCTCAAGCAGGGTTTTAC -3'

Sequencing Primer
(F):5'- CCAAATCAGTATAGGCTTCTCTTAC -3'
(R):5'- GCAGGGTTTTACTCAACAGAGATCC -3'

Posted On

2019-11-26