Incidental Mutation 'R7807:Sele'
ID 600839
Institutional Source Beutler Lab
Gene Symbol Sele
Ensembl Gene ENSMUSG00000026582
Gene Name selectin, endothelial cell
Synonyms Elam, CD62E, E-selectin
MMRRC Submission 045862-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.085) question?
Stock # R7807 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 163875773-163885246 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 163881462 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 523 (V523A)
Ref Sequence ENSEMBL: ENSMUSP00000027874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027874]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000027874
AA Change: V523A

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000027874
Gene: ENSMUSG00000026582
AA Change: V523A

DomainStartEndE-ValueType
CLECT 21 146 1.45e-21 SMART
EGF 149 182 2.83e-5 SMART
CCP 187 245 1.49e-9 SMART
CCP 250 307 5.43e-12 SMART
CCP 312 370 1.82e-13 SMART
CCP 375 433 1.36e-12 SMART
CCP 438 496 6e-14 SMART
CCP 501 555 1.39e-9 SMART
transmembrane domain 565 587 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in cytokine-stimulated endothelial cells and is thought to be responsible for the accumulation of blood leukocytes at sites of inflammation by mediating the adhesion of cells to the vascular lining. It exhibits structural features such as the presence of lectin- and EGF-like domains followed by short consensus repeat (SCR) domains that contain 6 conserved cysteine residues. These proteins are part of the selectin family of cell adhesion molecules. Adhesion molecules participate in the interaction between leukocytes and the endothelium and appear to be involved in the pathogenesis of atherosclerosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit mild defects in neutrophil infiltration during inflammatory responses. When combined with other selectin gene knockouts, more severe defects are present. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AB124611 C A 9: 21,447,276 (GRCm39) T146K probably benign Het
Alms1 T A 6: 85,599,958 (GRCm39) S1595T possibly damaging Het
Ankrd44 A T 1: 54,831,635 (GRCm39) I56N probably damaging Het
Anln C A 9: 22,272,176 (GRCm39) V648F probably damaging Het
Arhgap29 A G 3: 121,807,981 (GRCm39) D1053G probably benign Het
Baalc T C 15: 38,797,412 (GRCm39) S68P probably benign Het
Begain T C 12: 109,004,856 (GRCm39) D52G probably damaging Het
Blmh A G 11: 76,837,040 (GRCm39) I41V probably benign Het
Bpifc T A 10: 85,812,114 (GRCm39) I365F possibly damaging Het
C2 G T 17: 35,095,347 (GRCm39) S199R possibly damaging Het
Ccbe1 T A 18: 66,199,828 (GRCm39) H298L probably damaging Het
Ccdc112 T A 18: 46,423,826 (GRCm39) K304I probably damaging Het
Ccdc15 T C 9: 37,226,678 (GRCm39) E432G probably benign Het
Cdh13 T A 8: 119,010,594 (GRCm39) M1K probably null Het
Cipc T C 12: 87,008,899 (GRCm39) S253P possibly damaging Het
Clcn1 A G 6: 42,287,282 (GRCm39) probably null Het
Clock A T 5: 76,390,982 (GRCm39) N273K probably benign Het
Cyp19a1 T C 9: 54,074,126 (GRCm39) D476G probably benign Het
Dnaaf9 T C 2: 130,552,785 (GRCm39) K1092E probably damaging Het
Dnah7b A G 1: 46,253,527 (GRCm39) I1811V probably benign Het
Fat1 C A 8: 45,495,010 (GRCm39) T4091K probably damaging Het
Gm10340 T A 14: 14,826,724 (GRCm39) N64K probably damaging Het
Hectd1 G A 12: 51,792,171 (GRCm39) R2523C probably damaging Het
Hgf A G 5: 16,782,009 (GRCm39) H244R probably damaging Het
Hgs G T 11: 120,370,760 (GRCm39) A567S probably damaging Het
Igdcc4 T C 9: 65,041,077 (GRCm39) V1036A probably benign Het
Keg1 G A 19: 12,691,998 (GRCm39) probably null Het
Klhl8 A T 5: 104,023,932 (GRCm39) L156Q probably damaging Het
Lmln T C 16: 32,927,501 (GRCm39) Y521H probably benign Het
Lrrc7 A G 3: 157,866,124 (GRCm39) S1206P probably damaging Het
Mad1l1 T A 5: 140,074,541 (GRCm39) I550F probably benign Het
Marf1 C T 16: 13,971,753 (GRCm39) W28* probably null Het
Mfsd11 T G 11: 116,754,733 (GRCm39) S215A probably benign Het
Mpped2 C A 2: 106,575,085 (GRCm39) H57N possibly damaging Het
Mslnl A G 17: 25,965,751 (GRCm39) M542V probably benign Het
Myh6 G T 14: 55,179,897 (GRCm39) H1903Q probably damaging Het
Neo1 T C 9: 58,897,777 (GRCm39) T60A probably benign Het
Npm2 T A 14: 70,889,947 (GRCm39) probably null Het
Or5b123 C A 19: 13,597,285 (GRCm39) T210K probably damaging Het
Or5d20-ps1 T C 2: 87,931,909 (GRCm39) S141G probably benign Het
Or7a39 T A 10: 78,715,043 (GRCm39) S12R probably benign Het
Pax9 A T 12: 56,743,850 (GRCm39) I166F possibly damaging Het
Pcsk9 A G 4: 106,321,092 (GRCm39) S6P possibly damaging Het
Pikfyve A G 1: 65,309,101 (GRCm39) Y1893C probably damaging Het
Pirb T C 7: 3,722,864 (GRCm39) T43A possibly damaging Het
Pou3f1 A G 4: 124,552,074 (GRCm39) D192G possibly damaging Het
Pus3 C G 9: 35,478,021 (GRCm39) R418G probably damaging Het
Rexo1 C T 10: 80,385,970 (GRCm39) V363I probably benign Het
Sdcbp A G 4: 6,393,688 (GRCm39) T269A probably damaging Het
Serpinb8 T A 1: 107,532,457 (GRCm39) M183K probably damaging Het
Sh2d4a T G 8: 68,735,033 (GRCm39) S51A probably benign Het
Siglec15 A G 18: 78,090,696 (GRCm39) S201P probably damaging Het
Slc10a5 C T 3: 10,400,529 (GRCm39) V44I probably benign Het
Slc16a13 A G 11: 70,111,388 (GRCm39) V39A probably damaging Het
Slc25a13 G A 6: 6,117,164 (GRCm39) R184W probably damaging Het
Slc35f5 T A 1: 125,512,278 (GRCm39) D359E probably damaging Het
Slc3a1 A G 17: 85,371,371 (GRCm39) E641G probably benign Het
Slf1 T C 13: 77,194,823 (GRCm39) D834G probably damaging Het
Spata31f1e A C 4: 42,793,885 (GRCm39) H82Q probably benign Het
Stim1 T C 7: 102,076,348 (GRCm39) I433T probably damaging Het
Stra6 T A 9: 58,057,444 (GRCm39) I418K probably damaging Het
Tanc2 A G 11: 105,758,480 (GRCm39) N747S probably benign Het
Tet2 T C 3: 133,192,302 (GRCm39) T711A possibly damaging Het
Trpm6 T C 19: 18,807,220 (GRCm39) I988T probably benign Het
Ttc41 T A 10: 86,612,495 (GRCm39) I1256N probably benign Het
Uba2 T C 7: 33,862,638 (GRCm39) D100G possibly damaging Het
Vmn1r43 A G 6: 89,847,219 (GRCm39) I89T probably benign Het
Vmn2r58 T A 7: 41,521,910 (GRCm39) Y62F probably benign Het
Ylpm1 C T 12: 85,060,855 (GRCm39) Q428* probably null Het
Zcrb1 T C 15: 93,289,002 (GRCm39) D88G probably damaging Het
Zmym1 A C 4: 126,941,667 (GRCm39) I907S probably damaging Het
Other mutations in Sele
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Sele APN 1 163,879,403 (GRCm39) missense probably damaging 1.00
IGL02097:Sele APN 1 163,880,662 (GRCm39) missense probably benign 0.02
IGL02243:Sele APN 1 163,880,537 (GRCm39) missense probably benign 0.01
IGL02688:Sele APN 1 163,877,699 (GRCm39) missense probably damaging 1.00
IGL03022:Sele APN 1 163,882,248 (GRCm39) missense probably benign 0.01
R0433:Sele UTSW 1 163,876,813 (GRCm39) missense possibly damaging 0.74
R0487:Sele UTSW 1 163,881,184 (GRCm39) nonsense probably null
R0678:Sele UTSW 1 163,882,298 (GRCm39) critical splice donor site probably null
R1295:Sele UTSW 1 163,878,379 (GRCm39) missense probably damaging 1.00
R1296:Sele UTSW 1 163,878,379 (GRCm39) missense probably damaging 1.00
R1532:Sele UTSW 1 163,881,420 (GRCm39) missense probably benign 0.29
R1730:Sele UTSW 1 163,882,192 (GRCm39) missense probably benign
R2102:Sele UTSW 1 163,881,395 (GRCm39) missense probably damaging 1.00
R2384:Sele UTSW 1 163,878,344 (GRCm39) missense probably benign 0.00
R3001:Sele UTSW 1 163,881,140 (GRCm39) missense probably damaging 1.00
R3002:Sele UTSW 1 163,881,140 (GRCm39) missense probably damaging 1.00
R5851:Sele UTSW 1 163,877,143 (GRCm39) missense probably benign 0.06
R6164:Sele UTSW 1 163,879,386 (GRCm39) splice site probably null
R6239:Sele UTSW 1 163,878,377 (GRCm39) missense probably damaging 0.98
R6406:Sele UTSW 1 163,878,312 (GRCm39) missense probably damaging 1.00
R6411:Sele UTSW 1 163,876,984 (GRCm39) missense probably benign 0.03
R6731:Sele UTSW 1 163,881,242 (GRCm39) missense probably damaging 1.00
R6851:Sele UTSW 1 163,881,521 (GRCm39) missense probably damaging 1.00
R7291:Sele UTSW 1 163,881,437 (GRCm39) missense possibly damaging 0.89
R7328:Sele UTSW 1 163,876,844 (GRCm39) missense probably benign 0.23
R7366:Sele UTSW 1 163,876,288 (GRCm39) missense probably benign 0.00
R7393:Sele UTSW 1 163,881,492 (GRCm39) missense probably benign 0.05
R7431:Sele UTSW 1 163,879,189 (GRCm39) missense probably damaging 0.99
R7603:Sele UTSW 1 163,877,084 (GRCm39) missense probably damaging 1.00
R7803:Sele UTSW 1 163,878,263 (GRCm39) missense possibly damaging 0.88
R8323:Sele UTSW 1 163,879,207 (GRCm39) missense possibly damaging 0.59
R9018:Sele UTSW 1 163,881,248 (GRCm39) missense probably damaging 1.00
R9310:Sele UTSW 1 163,876,975 (GRCm39) missense probably benign 0.04
R9630:Sele UTSW 1 163,879,523 (GRCm39) missense probably damaging 0.99
X0005:Sele UTSW 1 163,876,912 (GRCm39) missense probably damaging 1.00
X0021:Sele UTSW 1 163,881,180 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ATCTCAGGGAAAGTGGACCC -3'
(R):5'- TTGGACATAATGGACAGTTAGCTTC -3'

Sequencing Primer
(F):5'- GTCCCCTCCTGCCAAGGTAAC -3'
(R):5'- CATAATGGACAGTTAGCTTCCTTAG -3'
Posted On 2019-11-26