Mutagenetix > Incidental Mutations

Incidental Mutation 'R7807:Arhgap29'

600844

Institutional Source

Beutler Lab

Gene Symbol

Arhgap29

Ensembl Gene

ENSMUSG00000039831

Gene Name

Rho GTPase activating protein 29

Synonyms

B130017I01Rik, 6720461J18Rik, C76601, Parg1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7807 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

121952541-122016753 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 122014332 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1053 (D1053G)

Ref Sequence

ENSEMBL: ENSMUSP00000044624 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037958] [ENSMUST00000197155]

Predicted Effect

probably benign
Transcript: ENSMUST00000037958
AA Change: D1053G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000044624
Gene: ENSMUSG00000039831
AA Change: D1053G

Domain	Start	End	E-Value	Type
low complexity region	5	12	N/A	INTRINSIC
PDB:3QWE\|A	193	469	5e-41	PDB
Blast:RhoGAP	412	595	9e-84	BLAST
C1	613	659	2.48e-6	SMART
RhoGAP	684	885	1.92e-68	SMART
low complexity region	947	961	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000197155

SMART Domains

Protein: ENSMUSP00000142945
Gene: ENSMUSG00000039831

Domain	Start	End	E-Value	Type
low complexity region	5	12	N/A	INTRINSIC
PDB:3QWE\|A	193	469	8e-42	PDB
Blast:RhoGAP	412	595	2e-87	BLAST
C1	613	659	2.48e-6	SMART
RhoGAP	684	780	1.14e-6	SMART

Predicted Effect

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rap1 is a small GTPase that, through effectors, regulates Rho GTPase signaling. These effectors- Rasip1, Radil, and the protein encoded by this gene- translocate to the cell membrane, where they form a multiprotein complex. This complex is necessary for Rap1-induced inhibition of Rho signaling. Defects in this gene may be a cause of nonsyndromic cleft lip with or without cleft palate. [provided by RefSeq, Jun 2016]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	T	C	2: 130,710,865	K1092E	probably damaging	Het
AB124611	C	A	9: 21,535,980	T146K	probably benign	Het
Alms1	T	A	6: 85,622,976	S1595T	possibly damaging	Het
Ankrd44	A	T	1: 54,792,476	I56N	probably damaging	Het
Anln	C	A	9: 22,360,880	V648F	probably damaging	Het
Baalc	T	C	15: 38,934,017	S68P	probably benign	Het
Begain	T	C	12: 109,038,930	D52G	probably damaging	Het
Blmh	A	G	11: 76,946,214	I41V	probably benign	Het
Bpifc	T	A	10: 85,976,250	I365F	possibly damaging	Het
C2	G	T	17: 34,876,371	S199R	possibly damaging	Het
Ccbe1	T	A	18: 66,066,757	H298L	probably damaging	Het
Ccdc112	T	A	18: 46,290,759	K304I	probably damaging	Het
Ccdc15	T	C	9: 37,315,382	E432G	probably benign	Het
Cdh13	T	A	8: 118,283,855	M1K	probably null	Het
Cipc	T	C	12: 86,962,125	S253P	possibly damaging	Het
Clcn1	A	G	6: 42,310,348		probably null	Het
Clock	A	T	5: 76,243,135	N273K	probably benign	Het
Cyp19a1	T	C	9: 54,166,842	D476G	probably benign	Het
Dnah7b	A	G	1: 46,214,367	I1811V	probably benign	Het
Fat1	C	A	8: 45,041,973	T4091K	probably damaging	Het
Gm10340	T	A	14: 3,134,925	N64K	probably damaging	Het
Gm12394	A	C	4: 42,793,885	H82Q	probably benign	Het
Hectd1	G	A	12: 51,745,388	R2523C	probably damaging	Het
Hgf	A	G	5: 16,577,011	H244R	probably damaging	Het
Hgs	G	T	11: 120,479,934	A567S	probably damaging	Het
Igdcc4	T	C	9: 65,133,795	V1036A	probably benign	Het
Keg1	G	A	19: 12,714,634		probably null	Het
Klhl8	A	T	5: 103,876,066	L156Q	probably damaging	Het
Lmln	T	C	16: 33,107,131	Y521H	probably benign	Het
Lrrc7	A	G	3: 158,160,487	S1206P	probably damaging	Het
Mad1l1	T	A	5: 140,088,786	I550F	probably benign	Het
Marf1	C	T	16: 14,153,889	W28*	probably null	Het
Mfsd11	T	G	11: 116,863,907	S215A	probably benign	Het
Mpped2	C	A	2: 106,744,740	H57N	possibly damaging	Het
Mslnl	A	G	17: 25,746,777	M542V	probably benign	Het
Myh6	G	T	14: 54,942,440	H1903Q	probably damaging	Het
Neo1	T	C	9: 58,990,494	T60A	probably benign	Het
Npm2	T	A	14: 70,652,507		probably null	Het
Olfr1165-ps	T	C	2: 88,101,565	S141G	probably benign	Het
Olfr1355	T	A	10: 78,879,209	S12R	probably benign	Het
Olfr1487	C	A	19: 13,619,921	T210K	probably damaging	Het
Pax9	A	T	12: 56,697,065	I166F	possibly damaging	Het
Pcsk9	A	G	4: 106,463,895	S6P	possibly damaging	Het
Pikfyve	A	G	1: 65,269,942	Y1893C	probably damaging	Het
Pirb	T	C	7: 3,719,865	T43A	possibly damaging	Het
Pou3f1	A	G	4: 124,658,281	D192G	possibly damaging	Het
Pus3	C	G	9: 35,566,725	R418G	probably damaging	Het
Rexo1	C	T	10: 80,550,136	V363I	probably benign	Het
Sdcbp	A	G	4: 6,393,688	T269A	probably damaging	Het
Sele	T	C	1: 164,053,893	V523A	probably benign	Het
Serpinb8	T	A	1: 107,604,727	M183K	probably damaging	Het
Sh2d4a	T	G	8: 68,282,381	S51A	probably benign	Het
Siglec15	A	G	18: 78,047,481	S201P	probably damaging	Het
Slc10a5	C	T	3: 10,335,469	V44I	probably benign	Het
Slc16a13	A	G	11: 70,220,562	V39A	probably damaging	Het
Slc25a13	G	A	6: 6,117,164	R184W	probably damaging	Het
Slc35f5	T	A	1: 125,584,541	D359E	probably damaging	Het
Slc3a1	A	G	17: 85,063,943	E641G	probably benign	Het
Slf1	T	C	13: 77,046,704	D834G	probably damaging	Het
Stim1	T	C	7: 102,427,141	I433T	probably damaging	Het
Stra6	T	A	9: 58,150,161	I418K	probably damaging	Het
Tanc2	A	G	11: 105,867,654	N747S	probably benign	Het
Tet2	T	C	3: 133,486,541	T711A	possibly damaging	Het
Trpm6	T	C	19: 18,829,856	I988T	probably benign	Het
Ttc41	T	A	10: 86,776,631	I1256N	probably benign	Het
Uba2	T	C	7: 34,163,213	D100G	possibly damaging	Het
Vmn1r43	A	G	6: 89,870,237	I89T	probably benign	Het
Vmn2r58	T	A	7: 41,872,486	Y62F	probably benign	Het
Ylpm1	C	T	12: 85,014,081	Q428*	probably null	Het
Zcrb1	T	C	15: 93,391,121	D88G	probably damaging	Het
Zmym1	A	C	4: 127,047,874	I907S	probably damaging	Het

Other mutations in Arhgap29

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00492:Arhgap29	APN	3	122003312	nonsense	probably null
IGL01121:Arhgap29	APN	3	122009863	missense	probably damaging	1.00
IGL01622:Arhgap29	APN	3	121974124	splice site	probably benign
IGL01623:Arhgap29	APN	3	121974124	splice site	probably benign
IGL01995:Arhgap29	APN	3	122014328	missense	probably benign	0.00
IGL02120:Arhgap29	APN	3	122004257	missense	probably benign	0.05
IGL02554:Arhgap29	APN	3	121992524	unclassified	probably benign
IGL02931:Arhgap29	APN	3	121992860	missense	probably benign
IGL02937:Arhgap29	APN	3	121974049	missense	probably damaging	0.99
PIT4362001:Arhgap29	UTSW	3	122003212	missense	probably benign	0.42
R0022:Arhgap29	UTSW	3	121988937	missense	possibly damaging	0.61
R0574:Arhgap29	UTSW	3	122007625	missense	probably benign	0.01
R0601:Arhgap29	UTSW	3	121991110	missense	probably damaging	1.00
R0639:Arhgap29	UTSW	3	122007641	missense	probably damaging	1.00
R0881:Arhgap29	UTSW	3	122014679	missense	probably damaging	1.00
R1232:Arhgap29	UTSW	3	122003340	missense	probably damaging	1.00
R1295:Arhgap29	UTSW	3	121992395	missense	probably benign	0.27
R1296:Arhgap29	UTSW	3	121992395	missense	probably benign	0.27
R1403:Arhgap29	UTSW	3	121973929	missense	probably damaging	1.00
R1403:Arhgap29	UTSW	3	121973929	missense	probably damaging	1.00
R1470:Arhgap29	UTSW	3	121992319	unclassified	probably benign
R1710:Arhgap29	UTSW	3	122008080	missense	probably damaging	1.00
R1878:Arhgap29	UTSW	3	122011371	missense	probably damaging	1.00
R2051:Arhgap29	UTSW	3	121981860	missense	probably benign	0.01
R2112:Arhgap29	UTSW	3	122011561	missense	probably benign	0.03
R2188:Arhgap29	UTSW	3	121991009	missense	probably damaging	1.00
R2240:Arhgap29	UTSW	3	122011453	missense	probably benign	0.12
R2420:Arhgap29	UTSW	3	121973980	missense	probably benign
R3618:Arhgap29	UTSW	3	121988527	missense	possibly damaging	0.62
R4673:Arhgap29	UTSW	3	122014971	missense	probably damaging	1.00
R4717:Arhgap29	UTSW	3	122009958	missense	possibly damaging	0.82
R5028:Arhgap29	UTSW	3	122010060	critical splice donor site	probably null
R5043:Arhgap29	UTSW	3	121974004	missense	probably benign	0.00
R5045:Arhgap29	UTSW	3	122002595	missense	probably benign	0.28
R5463:Arhgap29	UTSW	3	121988551	missense	possibly damaging	0.94
R5495:Arhgap29	UTSW	3	122014929	missense	probably damaging	1.00
R5743:Arhgap29	UTSW	3	121981911	missense	probably damaging	1.00
R5791:Arhgap29	UTSW	3	122014245	missense	probably damaging	0.98
R5896:Arhgap29	UTSW	3	122012087	missense	possibly damaging	0.78
R6083:Arhgap29	UTSW	3	121992748	missense	probably benign	0.00
R6355:Arhgap29	UTSW	3	122011258	missense	possibly damaging	0.46
R6451:Arhgap29	UTSW	3	121993581	missense	probably damaging	1.00
R6528:Arhgap29	UTSW	3	122014702	missense	probably benign	0.13
R7239:Arhgap29	UTSW	3	121988950	missense	probably benign	0.16
R7669:Arhgap29	UTSW	3	121992812	missense	probably damaging	1.00
R8045:Arhgap29	UTSW	3	122007562	synonymous	silent
R8048:Arhgap29	UTSW	3	121992901	missense	probably damaging	1.00
R8165:Arhgap29	UTSW	3	121988573	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TGGAAGATGTCTGTAAAAGCCCC -3'
(R):5'- GATGGTCCCTGTTATTCCCAG -3'

Sequencing Primer
(F):5'- TAAGCTTGCCTGTAGACC -3'
(R):5'- CTTCTCAGGGTAGGCACTGG -3'

Posted On

2019-11-26