Mutagenetix > Incidental Mutation

Incidental Mutation 'R7807:Tet2'

600845

Institutional Source

Beutler Lab

Gene Symbol

Tet2

Ensembl Gene

ENSMUSG00000040943

Gene Name

tet methylcytosine dioxygenase 2

Synonyms

E130014J05Rik, Ayu17-449

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_001040400.2; MGI:2443298

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7807 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

133463679-133545139 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 133486541 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 711 (T711A)

Ref Sequence

ENSEMBL: ENSMUSP00000143029 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098603] [ENSMUST00000196398] [ENSMUST00000197118]

AlphaFold

Q4JK59

Predicted Effect

possibly damaging
Transcript: ENSMUST00000098603
AA Change: T711A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000096203
Gene: ENSMUSG00000040943
AA Change: T711A

Domain	Start	End	E-Value	Type
low complexity region	690	701	N/A	INTRINSIC
low complexity region	855	862	N/A	INTRINSIC
low complexity region	884	895	N/A	INTRINSIC
low complexity region	899	921	N/A	INTRINSIC
Tet_JBP	1203	1819	7e-301	SMART
low complexity region	1832	1844	N/A	INTRINSIC
low complexity region	1885	1897	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000196398
AA Change: T711A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000143029
Gene: ENSMUSG00000040943
AA Change: T711A

Domain	Start	End	E-Value	Type
low complexity region	690	701	N/A	INTRINSIC
low complexity region	855	862	N/A	INTRINSIC
low complexity region	884	895	N/A	INTRINSIC
low complexity region	899	921	N/A	INTRINSIC
Tet_JBP	1211	1827	3.4e-305	SMART
low complexity region	1840	1852	N/A	INTRINSIC
low complexity region	1893	1905	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000197118

Meta Mutation Damage Score

0.0932

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (68/68)

MGI Phenotype

Strain: 5285413; 4345275; 3813933; 5301343
Lethality: D1-D2
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a methylcytosine dioxygenase that catalyzes the conversion of methylcytosine to 5-hydroxymethylcytosine. The encoded protein is involved in myelopoiesis, and defects in this gene have been associated with several myeloproliferative disorders. Two variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele die shortly after birth and exhibit a loss of acidic granules in the proximal convoluted tubules of the kidneys. Mice homozygous for a conditional allele activated in hematopoeitic compartment exhibit self-renewal and myeloid transforamtion. [provided by MGI curators]

Allele List at MGI

All alleles(1246) : Targeted(6) Gene trapped(1240)

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	T	C	2: 130,710,865	K1092E	probably damaging	Het
AB124611	C	A	9: 21,535,980	T146K	probably benign	Het
Alms1	T	A	6: 85,622,976	S1595T	possibly damaging	Het
Ankrd44	A	T	1: 54,792,476	I56N	probably damaging	Het
Anln	C	A	9: 22,360,880	V648F	probably damaging	Het
Arhgap29	A	G	3: 122,014,332	D1053G	probably benign	Het
Baalc	T	C	15: 38,934,017	S68P	probably benign	Het
Begain	T	C	12: 109,038,930	D52G	probably damaging	Het
Blmh	A	G	11: 76,946,214	I41V	probably benign	Het
Bpifc	T	A	10: 85,976,250	I365F	possibly damaging	Het
C2	G	T	17: 34,876,371	S199R	possibly damaging	Het
Ccbe1	T	A	18: 66,066,757	H298L	probably damaging	Het
Ccdc112	T	A	18: 46,290,759	K304I	probably damaging	Het
Ccdc15	T	C	9: 37,315,382	E432G	probably benign	Het
Cdh13	T	A	8: 118,283,855	M1K	probably null	Het
Cipc	T	C	12: 86,962,125	S253P	possibly damaging	Het
Clcn1	A	G	6: 42,310,348		probably null	Het
Clock	A	T	5: 76,243,135	N273K	probably benign	Het
Cyp19a1	T	C	9: 54,166,842	D476G	probably benign	Het
Dnah7b	A	G	1: 46,214,367	I1811V	probably benign	Het
Fat1	C	A	8: 45,041,973	T4091K	probably damaging	Het
Gm10340	T	A	14: 3,134,925	N64K	probably damaging	Het
Gm12394	A	C	4: 42,793,885	H82Q	probably benign	Het
Hectd1	G	A	12: 51,745,388	R2523C	probably damaging	Het
Hgf	A	G	5: 16,577,011	H244R	probably damaging	Het
Hgs	G	T	11: 120,479,934	A567S	probably damaging	Het
Igdcc4	T	C	9: 65,133,795	V1036A	probably benign	Het
Keg1	G	A	19: 12,714,634		probably null	Het
Klhl8	A	T	5: 103,876,066	L156Q	probably damaging	Het
Lmln	T	C	16: 33,107,131	Y521H	probably benign	Het
Lrrc7	A	G	3: 158,160,487	S1206P	probably damaging	Het
Mad1l1	T	A	5: 140,088,786	I550F	probably benign	Het
Marf1	C	T	16: 14,153,889	W28*	probably null	Het
Mfsd11	T	G	11: 116,863,907	S215A	probably benign	Het
Mpped2	C	A	2: 106,744,740	H57N	possibly damaging	Het
Mslnl	A	G	17: 25,746,777	M542V	probably benign	Het
Myh6	G	T	14: 54,942,440	H1903Q	probably damaging	Het
Neo1	T	C	9: 58,990,494	T60A	probably benign	Het
Npm2	T	A	14: 70,652,507		probably null	Het
Olfr1165-ps	T	C	2: 88,101,565	S141G	probably benign	Het
Olfr1355	T	A	10: 78,879,209	S12R	probably benign	Het
Olfr1487	C	A	19: 13,619,921	T210K	probably damaging	Het
Pax9	A	T	12: 56,697,065	I166F	possibly damaging	Het
Pcsk9	A	G	4: 106,463,895	S6P	possibly damaging	Het
Pikfyve	A	G	1: 65,269,942	Y1893C	probably damaging	Het
Pirb	T	C	7: 3,719,865	T43A	possibly damaging	Het
Pou3f1	A	G	4: 124,658,281	D192G	possibly damaging	Het
Pus3	C	G	9: 35,566,725	R418G	probably damaging	Het
Rexo1	C	T	10: 80,550,136	V363I	probably benign	Het
Sdcbp	A	G	4: 6,393,688	T269A	probably damaging	Het
Sele	T	C	1: 164,053,893	V523A	probably benign	Het
Serpinb8	T	A	1: 107,604,727	M183K	probably damaging	Het
Sh2d4a	T	G	8: 68,282,381	S51A	probably benign	Het
Siglec15	A	G	18: 78,047,481	S201P	probably damaging	Het
Slc10a5	C	T	3: 10,335,469	V44I	probably benign	Het
Slc16a13	A	G	11: 70,220,562	V39A	probably damaging	Het
Slc25a13	G	A	6: 6,117,164	R184W	probably damaging	Het
Slc35f5	T	A	1: 125,584,541	D359E	probably damaging	Het
Slc3a1	A	G	17: 85,063,943	E641G	probably benign	Het
Slf1	T	C	13: 77,046,704	D834G	probably damaging	Het
Stim1	T	C	7: 102,427,141	I433T	probably damaging	Het
Stra6	T	A	9: 58,150,161	I418K	probably damaging	Het
Tanc2	A	G	11: 105,867,654	N747S	probably benign	Het
Trpm6	T	C	19: 18,829,856	I988T	probably benign	Het
Ttc41	T	A	10: 86,776,631	I1256N	probably benign	Het
Uba2	T	C	7: 34,163,213	D100G	possibly damaging	Het
Vmn1r43	A	G	6: 89,870,237	I89T	probably benign	Het
Vmn2r58	T	A	7: 41,872,486	Y62F	probably benign	Het
Ylpm1	C	T	12: 85,014,081	Q428*	probably null	Het
Zcrb1	T	C	15: 93,391,121	D88G	probably damaging	Het
Zmym1	A	C	4: 127,047,874	I907S	probably damaging	Het

Other mutations in Tet2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Tet2	APN	3	133488085	missense	possibly damaging	0.96
IGL00401:Tet2	APN	3	133466882	missense	possibly damaging	0.72
IGL01528:Tet2	APN	3	133480298	missense	possibly damaging	0.86
IGL02053:Tet2	APN	3	133488523	missense	possibly damaging	0.96
IGL02142:Tet2	APN	3	133480139	missense	possibly damaging	0.96
IGL02512:Tet2	APN	3	133469308	missense	probably benign	0.05
IGL03148:Tet2	APN	3	133481363	missense	probably benign	0.18
IGL03182:Tet2	APN	3	133471398	nonsense	probably null
IGL03371:Tet2	APN	3	133467551	missense	possibly damaging	0.71
P0022:Tet2	UTSW	3	133486893	missense	probably benign	0.01
P0023:Tet2	UTSW	3	133486893	missense	probably benign	0.01
P0031:Tet2	UTSW	3	133480202	missense	possibly damaging	0.53
R0012:Tet2	UTSW	3	133476558	missense	probably damaging	0.98
R0012:Tet2	UTSW	3	133476558	missense	probably damaging	0.98
R0463:Tet2	UTSW	3	133486666	missense	possibly damaging	0.86
R0522:Tet2	UTSW	3	133466804	missense	probably damaging	0.98
R0593:Tet2	UTSW	3	133488109	missense	probably benign	0.00
R0600:Tet2	UTSW	3	133467602	missense	probably benign	0.00
R0600:Tet2	UTSW	3	133467725	missense	probably benign	0.01
R0698:Tet2	UTSW	3	133467384	missense	probably benign	0.32
R0723:Tet2	UTSW	3	133467284	missense	probably benign
R0726:Tet2	UTSW	3	133468184	missense	probably benign
R0747:Tet2	UTSW	3	133467470	missense	possibly damaging	0.86
R1006:Tet2	UTSW	3	133476601	missense	possibly damaging	0.53
R1382:Tet2	UTSW	3	133476615	missense	probably damaging	1.00
R1455:Tet2	UTSW	3	133473645	missense	possibly damaging	0.51
R1550:Tet2	UTSW	3	133469519	missense	probably benign	0.32
R1647:Tet2	UTSW	3	133485880	missense	probably benign
R1662:Tet2	UTSW	3	133466852	missense	possibly damaging	0.96
R1727:Tet2	UTSW	3	133487290	missense	probably damaging	0.98
R1738:Tet2	UTSW	3	133481387	missense	probably benign	0.08
R1749:Tet2	UTSW	3	133480131	critical splice donor site	probably null
R1869:Tet2	UTSW	3	133481441	splice site	probably null
R1887:Tet2	UTSW	3	133487333	missense	possibly damaging	0.68
R1937:Tet2	UTSW	3	133488638	missense	possibly damaging	0.68
R1939:Tet2	UTSW	3	133488638	missense	possibly damaging	0.68
R1940:Tet2	UTSW	3	133488638	missense	possibly damaging	0.68
R1997:Tet2	UTSW	3	133486589	nonsense	probably null
R2082:Tet2	UTSW	3	133485727	missense	possibly damaging	0.96
R2084:Tet2	UTSW	3	133487767	missense	possibly damaging	0.68
R2215:Tet2	UTSW	3	133486601	missense	probably benign	0.03
R2321:Tet2	UTSW	3	133486339	missense	possibly damaging	0.53
R2873:Tet2	UTSW	3	133486954	missense	probably damaging	1.00
R3439:Tet2	UTSW	3	133466831	missense	possibly damaging	0.93
R3783:Tet2	UTSW	3	133479363	missense	possibly damaging	0.53
R3894:Tet2	UTSW	3	133469477	missense	possibly damaging	0.86
R3916:Tet2	UTSW	3	133486055	missense	possibly damaging	0.53
R3966:Tet2	UTSW	3	133487657	missense	possibly damaging	0.73
R4457:Tet2	UTSW	3	133485563	missense	possibly damaging	0.85
R4633:Tet2	UTSW	3	133485549	missense	probably benign	0.33
R4646:Tet2	UTSW	3	133488082	missense	probably benign	0.02
R4647:Tet2	UTSW	3	133488082	missense	probably benign	0.02
R4648:Tet2	UTSW	3	133488082	missense	probably benign	0.02
R4691:Tet2	UTSW	3	133486083	missense	possibly damaging	0.73
R4805:Tet2	UTSW	3	133467315	missense	probably benign	0.32
R4829:Tet2	UTSW	3	133476620	missense	possibly damaging	0.91
R4901:Tet2	UTSW	3	133467044	missense	possibly damaging	0.86
R4975:Tet2	UTSW	3	133486759	unclassified	probably benign
R5004:Tet2	UTSW	3	133487379	missense	possibly damaging	0.84
R5075:Tet2	UTSW	3	133486906	missense	probably benign
R5137:Tet2	UTSW	3	133476565	missense	probably benign	0.32
R5324:Tet2	UTSW	3	133485913	missense	probably benign	0.00
R5590:Tet2	UTSW	3	133476480	splice site	probably null
R5854:Tet2	UTSW	3	133487885	missense	probably damaging	0.98
R5856:Tet2	UTSW	3	133486640	missense	probably benign	0.01
R5865:Tet2	UTSW	3	133487099	missense	probably benign	0.08
R5879:Tet2	UTSW	3	133487960	missense	possibly damaging	0.96
R5935:Tet2	UTSW	3	133488535	missense	possibly damaging	0.68
R6012:Tet2	UTSW	3	133466781	missense	possibly damaging	0.86
R6075:Tet2	UTSW	3	133471435	missense	possibly damaging	0.71
R6181:Tet2	UTSW	3	133487759	nonsense	probably null
R6188:Tet2	UTSW	3	133480326	missense	probably benign	0.18
R6339:Tet2	UTSW	3	133486417	missense	possibly damaging	0.53
R6612:Tet2	UTSW	3	133487335	missense	possibly damaging	0.53
R6923:Tet2	UTSW	3	133479341	critical splice donor site	probably null
R6934:Tet2	UTSW	3	133483237	critical splice donor site	probably null
R7076:Tet2	UTSW	3	133467023	missense	possibly damaging	0.71
R7155:Tet2	UTSW	3	133469591	missense	possibly damaging	0.71
R7184:Tet2	UTSW	3	133473630	missense	probably damaging	0.98
R7200:Tet2	UTSW	3	133487192	missense	probably benign	0.18
R7459:Tet2	UTSW	3	133480289	missense	possibly damaging	0.53
R7504:Tet2	UTSW	3	133487339	missense	probably benign	0.33
R7524:Tet2	UTSW	3	133480229	missense	probably benign	0.33
R7613:Tet2	UTSW	3	133466748	missense	possibly damaging	0.83
R7653:Tet2	UTSW	3	133486385	missense	probably benign	0.18
R7691:Tet2	UTSW	3	133486849	missense	probably damaging	0.98
R7770:Tet2	UTSW	3	133480295	missense	possibly damaging	0.53
R7813:Tet2	UTSW	3	133473643	missense	probably benign	0.06
R7978:Tet2	UTSW	3	133487665	missense	possibly damaging	0.96
R8055:Tet2	UTSW	3	133467992	missense	possibly damaging	0.93
R8164:Tet2	UTSW	3	133467134	missense	possibly damaging	0.85
R8236:Tet2	UTSW	3	133487786	missense	probably benign	0.00
R8755:Tet2	UTSW	3	133488278	missense	probably damaging	0.99
R8962:Tet2	UTSW	3	133488043	missense	probably benign	0.22
R9009:Tet2	UTSW	3	133487599	missense	possibly damaging	0.86
R9014:Tet2	UTSW	3	133467188	missense	probably damaging	0.99
R9128:Tet2	UTSW	3	133469613	missense	possibly damaging	0.85
R9166:Tet2	UTSW	3	133468172	missense	probably damaging	1.00
R9190:Tet2	UTSW	3	133481386	missense	possibly damaging	0.73
R9344:Tet2	UTSW	3	133469354	missense	possibly damaging	0.86
R9360:Tet2	UTSW	3	133487142	missense	possibly damaging	0.72
R9471:Tet2	UTSW	3	133485919	missense	probably damaging	1.00
R9488:Tet2	UTSW	3	133487342	missense	probably benign	0.18
R9534:Tet2	UTSW	3	133467928	nonsense	probably null
R9557:Tet2	UTSW	3	133485805	missense	probably benign
R9621:Tet2	UTSW	3	133488006	nonsense	probably null
R9644:Tet2	UTSW	3	133487303	nonsense	probably null
R9719:Tet2	UTSW	3	133486042	missense	possibly damaging	0.86
X0021:Tet2	UTSW	3	133486295	missense	possibly damaging	0.85
X0066:Tet2	UTSW	3	133488373	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- AAGGGAGAATCTGTAAGTTGCTC -3'
(R):5'- CATTTGAGTCAACAGGCCACAG -3'

Sequencing Primer
(F):5'- AGAATCTGTAAGTTGCTCGAATTTGG -3'
(R):5'- CAGAGACTCAACGGTTATCAGGC -3'

Posted On

2019-11-26